Incidental Mutation 'R5055:Scaper'
ID390784
Institutional Source Beutler Lab
Gene Symbol Scaper
Ensembl Gene ENSMUSG00000034007
Gene NameS phase cyclin A-associated protein in the ER
SynonymsD530014O03Rik, Zfp291
MMRRC Submission 042645-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #R5055 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location55549879-55938119 bp(-) (GRCm38)
Type of Mutationsplice site (29 bp from exon)
DNA Base Change (assembly) T to C at 55859719 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]
Predicted Effect probably null
Transcript: ENSMUST00000037408
SMART Domains Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007

DomainStartEndE-ValueType
Pfam:SCAPER_N 88 185 3.4e-47 PFAM
low complexity region 323 338 N/A INTRINSIC
coiled coil region 415 466 N/A INTRINSIC
coiled coil region 535 597 N/A INTRINSIC
SCOP:d1eq1a_ 605 769 3e-6 SMART
ZnF_C2H2 791 815 1.16e1 SMART
low complexity region 866 883 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000214747
Predicted Effect probably benign
Transcript: ENSMUST00000216595
Predicted Effect probably null
Transcript: ENSMUST00000217647
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (84/86)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 G A 11: 46,123,169 V329I probably damaging Het
Adgrl3 C A 5: 81,646,551 A541E possibly damaging Het
Agbl1 A T 7: 76,413,577 I263F probably damaging Het
Ash1l T C 3: 89,023,212 probably null Het
BC051142 G A 17: 34,448,796 C154Y possibly damaging Het
Bccip A G 7: 133,714,923 T91A probably benign Het
Bnc1 A T 7: 81,974,415 F355I probably damaging Het
Bpifa2 A T 2: 154,013,710 D185V probably damaging Het
Capn8 T A 1: 182,571,961 V89D probably damaging Het
Cfap46 A T 7: 139,661,190 M421K probably damaging Het
Chd2 A T 7: 73,480,508 L800M probably damaging Het
Chd4 A G 6: 125,100,986 D137G possibly damaging Het
Crtap A G 9: 114,390,140 Y154H probably benign Het
Ctdp1 T A 18: 80,456,088 Q213L probably damaging Het
Cts6 T C 13: 61,196,350 Y296C probably damaging Het
Daxx G T 17: 33,912,160 V354F probably benign Het
Dnah2 A G 11: 69,520,773 I341T possibly damaging Het
Epha2 A G 4: 141,309,069 D272G probably benign Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fbxl7 C A 15: 26,552,936 G82W probably damaging Het
Fcamr G A 1: 130,811,437 C158Y probably damaging Het
Fyb A C 15: 6,585,149 probably benign Het
Gars G A 6: 55,068,092 R454H probably damaging Het
Ghsr T C 3: 27,372,272 V159A probably benign Het
Glp1r A T 17: 30,918,887 Q97H probably benign Het
Gm27047 T C 6: 130,629,946 noncoding transcript Het
Igkv3-3 A C 6: 70,687,239 I22L probably benign Het
Inpp5b G T 4: 124,743,031 probably null Het
Ipo9 C A 1: 135,402,359 E448* probably null Het
Itgb2l A T 16: 96,427,803 I400N probably damaging Het
Kat6b T A 14: 21,516,994 H40Q probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnq2 G T 2: 181,086,761 probably benign Het
Klf7 T C 1: 64,079,280 T53A probably benign Het
Kmt2a A G 9: 44,818,352 probably benign Het
Lrp10 C T 14: 54,468,345 R331C probably benign Het
Map4k5 A T 12: 69,831,558 D289E probably benign Het
Mfsd4b2 A T 10: 39,923,777 M43K possibly damaging Het
Msr1 T G 8: 39,623,956 R138S possibly damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Myh9 G A 15: 77,764,523 A1711V probably benign Het
Myo18b A G 5: 112,875,217 probably benign Het
Nampt A T 12: 32,833,121 N102Y possibly damaging Het
Nell2 T C 15: 95,473,579 I92V probably benign Het
Nes A G 3: 87,977,214 N883D probably benign Het
Neurl3 T A 1: 36,273,382 probably benign Het
Ocln T A 13: 100,539,422 T188S probably benign Het
Olfr1023 T C 2: 85,887,241 F147S probably benign Het
Olfr704 T A 7: 106,865,730 M250K probably damaging Het
Parp14 T A 16: 35,844,363 Q1305L probably benign Het
Pde3a C T 6: 141,487,956 Q855* probably null Het
Pde4b T C 4: 102,195,114 probably benign Het
Pdk2 T C 11: 95,039,416 M65V probably benign Het
Phf21a T C 2: 92,351,856 S377P probably damaging Het
Plcb2 T A 2: 118,718,222 T408S probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ppp6r2 A G 15: 89,282,949 D789G probably benign Het
Prdm16 T C 4: 154,335,262 M897V possibly damaging Het
Prss57 A G 10: 79,784,344 probably null Het
Psd G T 19: 46,322,468 L381I probably benign Het
Ptprq A T 10: 107,534,679 D2050E probably benign Het
Rfc1 G T 5: 65,266,162 N1034K probably damaging Het
Ryr3 C T 2: 112,831,159 G1829S probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Slc28a1 A G 7: 81,169,048 N583S possibly damaging Het
Slc35e3 C T 10: 117,744,979 G140D probably damaging Het
Slc6a9 G A 4: 117,868,150 probably null Het
Sptlc1 A G 13: 53,342,182 S376P probably benign Het
Sspo G A 6: 48,464,795 C1913Y probably damaging Het
Taar7b A T 10: 24,000,947 I337F possibly damaging Het
Tdpoz2 T A 3: 93,651,928 I246F probably damaging Het
Trpa1 C T 1: 14,875,959 V983M probably damaging Het
Trpm5 A T 7: 143,072,784 M1112K probably benign Het
Uso1 A T 5: 92,192,735 K670I probably benign Het
Washc4 A G 10: 83,556,907 D257G probably damaging Het
Wdr41 T A 13: 95,015,217 probably null Het
Zbtb17 A G 4: 141,466,549 Q668R possibly damaging Het
Other mutations in Scaper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Scaper APN 9 55859859 missense probably damaging 0.99
IGL00912:Scaper APN 9 55685955 missense probably damaging 1.00
IGL01469:Scaper APN 9 55859767 missense probably damaging 1.00
IGL01626:Scaper APN 9 55912051 missense possibly damaging 0.61
IGL01779:Scaper APN 9 55892240 missense probably benign 0.20
IGL02011:Scaper APN 9 55580322 missense probably damaging 1.00
IGL02997:Scaper APN 9 55815499 missense probably damaging 1.00
IGL03107:Scaper APN 9 55858402 splice site probably benign
IGL03167:Scaper APN 9 55859824 missense probably damaging 1.00
IGL03293:Scaper APN 9 55874823 missense probably benign
IGL03340:Scaper APN 9 55602832 missense possibly damaging 0.88
IGL03368:Scaper APN 9 55656027 missense possibly damaging 0.53
R0111:Scaper UTSW 9 55602790 missense probably benign 0.01
R0510:Scaper UTSW 9 55758062 splice site probably benign
R0531:Scaper UTSW 9 55609874 missense possibly damaging 0.91
R0558:Scaper UTSW 9 55685923 missense probably benign 0.08
R0605:Scaper UTSW 9 55815518 splice site probably benign
R0646:Scaper UTSW 9 55758056 missense probably damaging 1.00
R0837:Scaper UTSW 9 55859042 nonsense probably null
R1440:Scaper UTSW 9 55602918 nonsense probably null
R1548:Scaper UTSW 9 55816670 missense probably damaging 1.00
R1777:Scaper UTSW 9 55864546 missense probably benign 0.33
R1822:Scaper UTSW 9 55859900 missense probably damaging 0.99
R1834:Scaper UTSW 9 55816734 missense possibly damaging 0.90
R1870:Scaper UTSW 9 55685938 missense probably damaging 1.00
R2102:Scaper UTSW 9 55912050 missense probably benign 0.43
R2168:Scaper UTSW 9 55743639 missense probably damaging 1.00
R2174:Scaper UTSW 9 55859037 missense probably null 0.01
R3690:Scaper UTSW 9 55883921 missense probably benign 0.00
R4392:Scaper UTSW 9 55858115 missense probably damaging 0.99
R4418:Scaper UTSW 9 55838180 missense probably damaging 1.00
R4606:Scaper UTSW 9 55655903 critical splice donor site probably null
R4643:Scaper UTSW 9 55838179 missense probably damaging 0.99
R4665:Scaper UTSW 9 55912055 missense probably damaging 1.00
R4739:Scaper UTSW 9 55743648 missense probably damaging 1.00
R4921:Scaper UTSW 9 55892235 missense probably benign 0.02
R4934:Scaper UTSW 9 55809175 missense probably damaging 1.00
R4956:Scaper UTSW 9 55838142 missense probably damaging 1.00
R5107:Scaper UTSW 9 55580332 missense probably damaging 1.00
R5155:Scaper UTSW 9 55556086 missense probably null 1.00
R5265:Scaper UTSW 9 55864546 missense probably benign
R5408:Scaper UTSW 9 55586224 missense probably damaging 0.99
R5623:Scaper UTSW 9 55864507 missense probably benign 0.02
R5665:Scaper UTSW 9 55807632 missense probably damaging 1.00
R5748:Scaper UTSW 9 55859076 critical splice acceptor site probably null
R5771:Scaper UTSW 9 55816791 missense probably damaging 1.00
R6534:Scaper UTSW 9 55883976 missense probably benign 0.00
R6557:Scaper UTSW 9 55550850 missense probably benign 0.02
R6651:Scaper UTSW 9 55858504 missense probably benign 0.05
R6796:Scaper UTSW 9 55864427 missense probably benign 0.00
R6962:Scaper UTSW 9 55859771 missense probably benign 0.01
R7145:Scaper UTSW 9 55912111 missense unknown
R7199:Scaper UTSW 9 55838176 nonsense probably null
R7356:Scaper UTSW 9 55892211 missense unknown
R7426:Scaper UTSW 9 55762277 nonsense probably null
R7503:Scaper UTSW 9 55807754 missense probably damaging 0.98
R7844:Scaper UTSW 9 55815448 missense probably benign 0.04
R7966:Scaper UTSW 9 55762327 missense probably damaging 0.98
R7992:Scaper UTSW 9 55858154 missense probably benign 0.02
R8081:Scaper UTSW 9 55916046 missense unknown
R8189:Scaper UTSW 9 55912120 missense probably damaging 1.00
R8294:Scaper UTSW 9 55609996 missense possibly damaging 0.62
R8351:Scaper UTSW 9 55816804 missense possibly damaging 0.92
R8451:Scaper UTSW 9 55816804 missense possibly damaging 0.92
R8473:Scaper UTSW 9 55550847 missense probably damaging 1.00
R8476:Scaper UTSW 9 55762291 missense probably damaging 1.00
R8504:Scaper UTSW 9 55864438 missense probably benign
X0012:Scaper UTSW 9 55655930 missense probably damaging 0.98
X0052:Scaper UTSW 9 55816664 missense probably damaging 1.00
Z1176:Scaper UTSW 9 55556248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCCCTAGAAATTACAATCTGAAG -3'
(R):5'- AGTCTATGGCAGAAGTTCTCGC -3'

Sequencing Primer
(F):5'- AAGAATATTGGGTTCTTCCTTTCTG -3'
(R):5'- CAATGAAGAAGCCATCGC -3'
Posted On2016-06-06