Incidental Mutation 'R5055:Nampt'
ID390797
Institutional Source Beutler Lab
Gene Symbol Nampt
Ensembl Gene ENSMUSG00000020572
Gene Namenicotinamide phosphoribosyltransferase
SynonymsPbef1, 1110035O14Rik, Visfatin
MMRRC Submission 042645-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5055 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location32819545-32853349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32833121 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 102 (N102Y)
Ref Sequence ENSEMBL: ENSMUSP00000020886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020886] [ENSMUST00000220200]
PDB Structure Crystal Structure of Murine NMPRTase [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor 1 [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor in Complex with Nicotinamide Mononuleotide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020886
AA Change: N102Y

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020886
Gene: ENSMUSG00000020572
AA Change: N102Y

DomainStartEndE-ValueType
Pfam:NAPRTase 188 466 1.6e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218491
Predicted Effect probably benign
Transcript: ENSMUST00000220200
Meta Mutation Damage Score 0.1720 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to E10.5. Mice heterozygous for a null allele exhibit increased fasted glucose in male mice and impaired glucose tolerance and decresed glucose-stimulated insulin secretion in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 G A 11: 46,123,169 V329I probably damaging Het
Adgrl3 C A 5: 81,646,551 A541E possibly damaging Het
Agbl1 A T 7: 76,413,577 I263F probably damaging Het
Ash1l T C 3: 89,023,212 probably null Het
BC051142 G A 17: 34,448,796 C154Y possibly damaging Het
Bccip A G 7: 133,714,923 T91A probably benign Het
Bnc1 A T 7: 81,974,415 F355I probably damaging Het
Bpifa2 A T 2: 154,013,710 D185V probably damaging Het
Capn8 T A 1: 182,571,961 V89D probably damaging Het
Cfap46 A T 7: 139,661,190 M421K probably damaging Het
Chd2 A T 7: 73,480,508 L800M probably damaging Het
Chd4 A G 6: 125,100,986 D137G possibly damaging Het
Crtap A G 9: 114,390,140 Y154H probably benign Het
Ctdp1 T A 18: 80,456,088 Q213L probably damaging Het
Cts6 T C 13: 61,196,350 Y296C probably damaging Het
Daxx G T 17: 33,912,160 V354F probably benign Het
Dnah2 A G 11: 69,520,773 I341T possibly damaging Het
Epha2 A G 4: 141,309,069 D272G probably benign Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fbxl7 C A 15: 26,552,936 G82W probably damaging Het
Fcamr G A 1: 130,811,437 C158Y probably damaging Het
Fyb A C 15: 6,585,149 probably benign Het
Gars G A 6: 55,068,092 R454H probably damaging Het
Ghsr T C 3: 27,372,272 V159A probably benign Het
Glp1r A T 17: 30,918,887 Q97H probably benign Het
Gm27047 T C 6: 130,629,946 noncoding transcript Het
Igkv3-3 A C 6: 70,687,239 I22L probably benign Het
Inpp5b G T 4: 124,743,031 probably null Het
Ipo9 C A 1: 135,402,359 E448* probably null Het
Itgb2l A T 16: 96,427,803 I400N probably damaging Het
Kat6b T A 14: 21,516,994 H40Q probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnq2 G T 2: 181,086,761 probably benign Het
Klf7 T C 1: 64,079,280 T53A probably benign Het
Kmt2a A G 9: 44,818,352 probably benign Het
Lrp10 C T 14: 54,468,345 R331C probably benign Het
Map4k5 A T 12: 69,831,558 D289E probably benign Het
Mfsd4b2 A T 10: 39,923,777 M43K possibly damaging Het
Msr1 T G 8: 39,623,956 R138S possibly damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Myh9 G A 15: 77,764,523 A1711V probably benign Het
Myo18b A G 5: 112,875,217 probably benign Het
Nell2 T C 15: 95,473,579 I92V probably benign Het
Nes A G 3: 87,977,214 N883D probably benign Het
Neurl3 T A 1: 36,273,382 probably benign Het
Ocln T A 13: 100,539,422 T188S probably benign Het
Olfr1023 T C 2: 85,887,241 F147S probably benign Het
Olfr704 T A 7: 106,865,730 M250K probably damaging Het
Parp14 T A 16: 35,844,363 Q1305L probably benign Het
Pde3a C T 6: 141,487,956 Q855* probably null Het
Pde4b T C 4: 102,195,114 probably benign Het
Pdk2 T C 11: 95,039,416 M65V probably benign Het
Phf21a T C 2: 92,351,856 S377P probably damaging Het
Plcb2 T A 2: 118,718,222 T408S probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ppp6r2 A G 15: 89,282,949 D789G probably benign Het
Prdm16 T C 4: 154,335,262 M897V possibly damaging Het
Prss57 A G 10: 79,784,344 probably null Het
Psd G T 19: 46,322,468 L381I probably benign Het
Ptprq A T 10: 107,534,679 D2050E probably benign Het
Rfc1 G T 5: 65,266,162 N1034K probably damaging Het
Ryr3 C T 2: 112,831,159 G1829S probably benign Het
Scaper T C 9: 55,859,719 probably null Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Slc28a1 A G 7: 81,169,048 N583S possibly damaging Het
Slc35e3 C T 10: 117,744,979 G140D probably damaging Het
Slc6a9 G A 4: 117,868,150 probably null Het
Sptlc1 A G 13: 53,342,182 S376P probably benign Het
Sspo G A 6: 48,464,795 C1913Y probably damaging Het
Taar7b A T 10: 24,000,947 I337F possibly damaging Het
Tdpoz2 T A 3: 93,651,928 I246F probably damaging Het
Trpa1 C T 1: 14,875,959 V983M probably damaging Het
Trpm5 A T 7: 143,072,784 M1112K probably benign Het
Uso1 A T 5: 92,192,735 K670I probably benign Het
Washc4 A G 10: 83,556,907 D257G probably damaging Het
Wdr41 T A 13: 95,015,217 probably null Het
Zbtb17 A G 4: 141,466,549 Q668R possibly damaging Het
Other mutations in Nampt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Nampt APN 12 32830216 missense probably damaging 1.00
IGL02512:Nampt APN 12 32830269 missense possibly damaging 0.72
IGL03095:Nampt APN 12 32842686 missense possibly damaging 0.85
Nacht UTSW 12 32833038 missense probably damaging 1.00
R0020:Nampt UTSW 12 32841013 missense probably damaging 0.97
R0417:Nampt UTSW 12 32833101 missense probably benign 0.01
R1087:Nampt UTSW 12 32833043 missense possibly damaging 0.88
R1781:Nampt UTSW 12 32833038 missense probably damaging 1.00
R2137:Nampt UTSW 12 32830310 missense probably benign
R2138:Nampt UTSW 12 32838422 missense possibly damaging 0.46
R3699:Nampt UTSW 12 32848759 splice site probably benign
R3970:Nampt UTSW 12 32833096 missense probably benign 0.02
R4434:Nampt UTSW 12 32838363 missense probably damaging 1.00
R4785:Nampt UTSW 12 32848714 missense possibly damaging 0.95
R5046:Nampt UTSW 12 32833038 missense probably damaging 1.00
R5427:Nampt UTSW 12 32834915 missense probably benign 0.00
R6063:Nampt UTSW 12 32848659 missense probably damaging 1.00
R6136:Nampt UTSW 12 32830302 missense probably benign 0.24
R6995:Nampt UTSW 12 32848743 missense probably benign 0.24
R7569:Nampt UTSW 12 32850434 missense probably benign
R8801:Nampt UTSW 12 32838374 missense possibly damaging 0.62
R8802:Nampt UTSW 12 32850436 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCAGTCATGAGCTGGGTGAG -3'
(R):5'- CTACTGTAAGCTACTGGTTAGTGATTC -3'

Sequencing Primer
(F):5'- GAGAGCTGAGAACCCTGCTG -3'
(R):5'- CTGGTTAGTGATTCATACTACAGGAG -3'
Posted On2016-06-06