Incidental Mutation 'R5055:Itgb2l'
ID390811
Institutional Source Beutler Lab
Gene Symbol Itgb2l
Ensembl Gene ENSMUSG00000000157
Gene Nameintegrin beta 2-like
Synonymspactolus, 5033406G21Rik
MMRRC Submission 042645-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5055 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location96422288-96443619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96427803 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 400 (I400N)
Ref Sequence ENSEMBL: ENSMUSP00000114497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000161] [ENSMUST00000113773] [ENSMUST00000113795] [ENSMUST00000131567]
PDB Structure
PACTOLUS I-DOMAIN: FUNCTIONAL SWITCHING OF THE ROSSMANN FOLD [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000000161
AA Change: I400N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000161
Gene: ENSMUSG00000000157
AA Change: I400N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113773
AA Change: I400N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109403
Gene: ENSMUSG00000000157
AA Change: I400N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113795
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131567
AA Change: I400N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114497
Gene: ENSMUSG00000000157
AA Change: I400N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131777
Meta Mutation Damage Score 0.9109 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (84/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display normal leukocyte development and normal neutrophil recruitment to inflamed tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 G A 11: 46,123,169 V329I probably damaging Het
Adgrl3 C A 5: 81,646,551 A541E possibly damaging Het
Agbl1 A T 7: 76,413,577 I263F probably damaging Het
Ash1l T C 3: 89,023,212 probably null Het
BC051142 G A 17: 34,448,796 C154Y possibly damaging Het
Bccip A G 7: 133,714,923 T91A probably benign Het
Bnc1 A T 7: 81,974,415 F355I probably damaging Het
Bpifa2 A T 2: 154,013,710 D185V probably damaging Het
Capn8 T A 1: 182,571,961 V89D probably damaging Het
Cfap46 A T 7: 139,661,190 M421K probably damaging Het
Chd2 A T 7: 73,480,508 L800M probably damaging Het
Chd4 A G 6: 125,100,986 D137G possibly damaging Het
Crtap A G 9: 114,390,140 Y154H probably benign Het
Ctdp1 T A 18: 80,456,088 Q213L probably damaging Het
Cts6 T C 13: 61,196,350 Y296C probably damaging Het
Daxx G T 17: 33,912,160 V354F probably benign Het
Dnah2 A G 11: 69,520,773 I341T possibly damaging Het
Epha2 A G 4: 141,309,069 D272G probably benign Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fbxl7 C A 15: 26,552,936 G82W probably damaging Het
Fcamr G A 1: 130,811,437 C158Y probably damaging Het
Fyb A C 15: 6,585,149 probably benign Het
Gars G A 6: 55,068,092 R454H probably damaging Het
Ghsr T C 3: 27,372,272 V159A probably benign Het
Glp1r A T 17: 30,918,887 Q97H probably benign Het
Gm27047 T C 6: 130,629,946 noncoding transcript Het
Igkv3-3 A C 6: 70,687,239 I22L probably benign Het
Inpp5b G T 4: 124,743,031 probably null Het
Ipo9 C A 1: 135,402,359 E448* probably null Het
Kat6b T A 14: 21,516,994 H40Q probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnq2 G T 2: 181,086,761 probably benign Het
Klf7 T C 1: 64,079,280 T53A probably benign Het
Kmt2a A G 9: 44,818,352 probably benign Het
Lrp10 C T 14: 54,468,345 R331C probably benign Het
Map4k5 A T 12: 69,831,558 D289E probably benign Het
Mfsd4b2 A T 10: 39,923,777 M43K possibly damaging Het
Msr1 T G 8: 39,623,956 R138S possibly damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Myh9 G A 15: 77,764,523 A1711V probably benign Het
Myo18b A G 5: 112,875,217 probably benign Het
Nampt A T 12: 32,833,121 N102Y possibly damaging Het
Nell2 T C 15: 95,473,579 I92V probably benign Het
Nes A G 3: 87,977,214 N883D probably benign Het
Neurl3 T A 1: 36,273,382 probably benign Het
Ocln T A 13: 100,539,422 T188S probably benign Het
Olfr1023 T C 2: 85,887,241 F147S probably benign Het
Olfr704 T A 7: 106,865,730 M250K probably damaging Het
Parp14 T A 16: 35,844,363 Q1305L probably benign Het
Pde3a C T 6: 141,487,956 Q855* probably null Het
Pde4b T C 4: 102,195,114 probably benign Het
Pdk2 T C 11: 95,039,416 M65V probably benign Het
Phf21a T C 2: 92,351,856 S377P probably damaging Het
Plcb2 T A 2: 118,718,222 T408S probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ppp6r2 A G 15: 89,282,949 D789G probably benign Het
Prdm16 T C 4: 154,335,262 M897V possibly damaging Het
Prss57 A G 10: 79,784,344 probably null Het
Psd G T 19: 46,322,468 L381I probably benign Het
Ptprq A T 10: 107,534,679 D2050E probably benign Het
Rfc1 G T 5: 65,266,162 N1034K probably damaging Het
Ryr3 C T 2: 112,831,159 G1829S probably benign Het
Scaper T C 9: 55,859,719 probably null Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Slc28a1 A G 7: 81,169,048 N583S possibly damaging Het
Slc35e3 C T 10: 117,744,979 G140D probably damaging Het
Slc6a9 G A 4: 117,868,150 probably null Het
Sptlc1 A G 13: 53,342,182 S376P probably benign Het
Sspo G A 6: 48,464,795 C1913Y probably damaging Het
Taar7b A T 10: 24,000,947 I337F possibly damaging Het
Tdpoz2 T A 3: 93,651,928 I246F probably damaging Het
Trpa1 C T 1: 14,875,959 V983M probably damaging Het
Trpm5 A T 7: 143,072,784 M1112K probably benign Het
Uso1 A T 5: 92,192,735 K670I probably benign Het
Washc4 A G 10: 83,556,907 D257G probably damaging Het
Wdr41 T A 13: 95,015,217 probably null Het
Zbtb17 A G 4: 141,466,549 Q668R possibly damaging Het
Other mutations in Itgb2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Itgb2l APN 16 96426750 missense probably damaging 0.98
IGL01482:Itgb2l APN 16 96438748 missense probably damaging 0.99
IGL01767:Itgb2l APN 16 96430575 missense probably benign 0.05
IGL02056:Itgb2l APN 16 96427689 missense probably damaging 0.97
IGL02072:Itgb2l APN 16 96430608 missense probably benign
IGL02858:Itgb2l APN 16 96422650 missense possibly damaging 0.96
R0011:Itgb2l UTSW 16 96427661 splice site probably benign
R0153:Itgb2l UTSW 16 96437369 missense possibly damaging 0.94
R0270:Itgb2l UTSW 16 96422930 unclassified probably benign
R0496:Itgb2l UTSW 16 96434701 missense possibly damaging 0.86
R0627:Itgb2l UTSW 16 96422911 unclassified probably benign
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1509:Itgb2l UTSW 16 96426849 missense probably benign 0.28
R1792:Itgb2l UTSW 16 96425082 missense probably damaging 1.00
R1912:Itgb2l UTSW 16 96426935 missense probably benign 0.17
R2210:Itgb2l UTSW 16 96426221 missense possibly damaging 0.82
R3160:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3162:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3836:Itgb2l UTSW 16 96426167 missense probably benign
R4131:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4132:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4254:Itgb2l UTSW 16 96430577 missense probably benign 0.00
R4854:Itgb2l UTSW 16 96426117 nonsense probably null
R4893:Itgb2l UTSW 16 96427821 missense probably benign 0.12
R4931:Itgb2l UTSW 16 96437449 missense probably damaging 1.00
R5039:Itgb2l UTSW 16 96425005 missense possibly damaging 0.69
R5960:Itgb2l UTSW 16 96426259 missense probably benign 0.00
R6412:Itgb2l UTSW 16 96427729 missense probably benign 0.04
R6966:Itgb2l UTSW 16 96430643 missense probably benign 0.02
R7149:Itgb2l UTSW 16 96433559 missense probably damaging 1.00
R7278:Itgb2l UTSW 16 96429043 missense probably damaging 1.00
R7293:Itgb2l UTSW 16 96426796 nonsense probably null
R7482:Itgb2l UTSW 16 96426833 missense probably benign 0.01
R7570:Itgb2l UTSW 16 96426239 missense probably benign 0.00
R7743:Itgb2l UTSW 16 96437408 missense probably damaging 1.00
R7771:Itgb2l UTSW 16 96426972 missense probably damaging 1.00
R8446:Itgb2l UTSW 16 96432657 missense probably damaging 1.00
X0018:Itgb2l UTSW 16 96435676 missense probably benign 0.01
Z1177:Itgb2l UTSW 16 96437356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGACAGGTGTCTACAGG -3'
(R):5'- TGCTTCAGAGAGAACCCATACC -3'

Sequencing Primer
(F):5'- GTGGGCTTTCTAGGTACACC -3'
(R):5'- CATCCCTCCTATGACATCATTTTGG -3'
Posted On2016-06-06