Incidental Mutation 'R5056:Cenpb'
ID390827
Institutional Source Beutler Lab
Gene Symbol Cenpb
Ensembl Gene ENSMUSG00000068267
Gene Namecentromere protein B
Synonyms
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R5056 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131175182-131180067 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 131178171 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028801] [ENSMUST00000089510] [ENSMUST00000110218]
Predicted Effect probably benign
Transcript: ENSMUST00000028801
SMART Domains Protein: ENSMUSP00000028801
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 13 109 9.3e-36 PFAM
Pfam:CAMSAP_CH 14 96 7.9e-24 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000089510
AA Change: S569N
SMART Domains Protein: ENSMUSP00000086938
Gene: ENSMUSG00000068267
AA Change: S569N

DomainStartEndE-ValueType
Pfam:CENP-B_N 2 56 1.6e-26 PFAM
CENPB 71 136 7.05e-23 SMART
low complexity region 140 158 N/A INTRINSIC
Pfam:DDE_1 222 384 4.9e-44 PFAM
coiled coil region 402 439 N/A INTRINSIC
Pfam:CENP-B_dimeris 499 598 5.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110218
SMART Domains Protein: ENSMUSP00000105847
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH 10 103 1.2e-7 PFAM
Pfam:DUF1042 13 164 5.7e-58 PFAM
Pfam:CAMSAP_CH 14 96 9e-23 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127987
SMART Domains Protein: ENSMUSP00000114178
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 7 103 1.7e-36 PFAM
Pfam:CAMSAP_CH 8 90 6e-24 PFAM
Meta Mutation Damage Score 0.0829 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a highly conserved protein that facilitates centromere formation. It is a DNA-binding protein that is derived from transposases of the pogo DNA transposon family. It contains a helix-loop-helix DNA binding motif at the N-terminus, and a dimerization domain at the C-terminus. The DNA binding domain recognizes and binds a 17-bp sequence (CENP-B box) in the centromeric alpha satellite DNA. This protein is proposed to play an important role in the assembly of specific centromere structures in interphase nuclei and on mitotic chromosomes. It is also considered a major centromere autoantigen recognized by sera from patients with anti-centromere antibodies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display decreased body weight, small testis, oligospermia, and an age- and background-dependent reduction in female reproductive competence associated with abnormalities in uterus morphology, metral environment, gestational length, and parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Cenpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02421:Cenpb APN 2 131179681 missense probably damaging 1.00
R0183:Cenpb UTSW 2 131178453 unclassified probably benign
R1378:Cenpb UTSW 2 131178310 unclassified probably benign
R1934:Cenpb UTSW 2 131179264 missense probably benign
R2086:Cenpb UTSW 2 131178597 unclassified probably benign
R2132:Cenpb UTSW 2 131179306 missense probably damaging 1.00
R4776:Cenpb UTSW 2 131178183 unclassified probably benign
R5120:Cenpb UTSW 2 131179818 missense probably benign 0.00
R5617:Cenpb UTSW 2 131179014 missense probably damaging 0.99
R6297:Cenpb UTSW 2 131178369 unclassified probably benign
R6467:Cenpb UTSW 2 131179557 missense probably damaging 1.00
R6673:Cenpb UTSW 2 131179245 missense probably damaging 0.98
R6916:Cenpb UTSW 2 131179624 missense probably benign 0.04
R7102:Cenpb UTSW 2 131178879 missense probably damaging 0.99
R7888:Cenpb UTSW 2 131179842 missense probably damaging 0.99
R7971:Cenpb UTSW 2 131179842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCGTTGCTGAAAGCCCTG -3'
(R):5'- ATAGTGTCCAGGAAGAGGCC -3'

Sequencing Primer
(F):5'- TCTCCAGCCATCTCCAGCAG -3'
(R):5'- GACTCTGACTCAGACAGTGATG -3'
Posted On2016-06-06