Mutagenetix > Incidental Mutations

Incidental Mutation 'R5056:Kcnd3'

390829

Institutional Source

Beutler Lab

Gene Symbol

Kcnd3

Ensembl Gene

ENSMUSG00000040896

Gene Name

potassium voltage-gated channel, Shal-related family, member 3

Synonyms

Kv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L

MMRRC Submission

042646-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5056 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105452330-105674002 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 105666928 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]

Predicted Effect

probably benign
Transcript: ENSMUST00000079169

SMART Domains

Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098761

SMART Domains

Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	7.3e-19	PFAM
BTB	40	139	1.76e-16	SMART
transmembrane domain	180	202	N/A	INTRINSIC
Pfam:Ion_trans	228	402	1e-31	PFAM
Pfam:Ion_trans_2	327	408	8.4e-15	PFAM
low complexity region	412	431	N/A	INTRINSIC
Pfam:DUF3399	442	545	9.5e-52	PFAM
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118360

SMART Domains

Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141694

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147209

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.2%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030J22Rik	T	A	8: 116,971,682	K229*	probably null	Het
9930021J03Rik	A	T	19: 29,717,359	I1578K	probably benign	Het
Adora2a	T	A	10: 75,326,158	S44T	probably damaging	Het
Agap3	T	C	5: 24,477,862	V459A	probably damaging	Het
Apc2	T	C	10: 80,301,314	V31A	probably benign	Het
Asic2	T	A	11: 80,971,603	K189N	possibly damaging	Het
Bbs10	C	T	10: 111,300,540	P505S	probably benign	Het
C87414	T	C	5: 93,638,925		probably benign	Het
Cdh20	G	T	1: 104,953,997	V396L	probably benign	Het
Cenpb	C	T	2: 131,178,171		probably benign	Het
Chil6	T	A	3: 106,394,343	Y147F	probably damaging	Het
Cluh	C	T	11: 74,661,946	R606C	probably damaging	Het
Cmtr1	A	G	17: 29,690,328	T404A	possibly damaging	Het
Cnot1	T	C	8: 95,741,008	N1499S	probably damaging	Het
Dmkn	T	C	7: 30,764,104	S61P	probably damaging	Het
Dmxl1	T	C	18: 49,870,923	C872R	probably benign	Het
Dnah3	A	G	7: 120,020,946	Y1587H	probably damaging	Het
Dsc2	A	T	18: 20,050,142	V73D	probably damaging	Het
F5	A	T	1: 164,192,032	Y692F	possibly damaging	Het
Fam184a	A	T	10: 53,674,574	L80I	probably damaging	Het
Fam46b	C	T	4: 133,480,438	R47W	possibly damaging	Het
Foxj2	A	G	6: 122,833,874	H271R	probably benign	Het
Grm7	A	G	6: 111,080,443	T335A	probably damaging	Het
Hspa9	A	G	18: 34,938,681	L622P	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Klhdc8b	ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC	ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC	9: 108,448,985		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrch4	C	G	5: 137,636,851	N237K	probably damaging	Het
Lss	T	G	10: 76,552,926		probably null	Het
Map6	T	C	7: 99,336,652	F588L	probably benign	Het
Mbd6	C	T	10: 127,286,441	V173I	probably benign	Het
Med13	A	T	11: 86,328,565	S352T	probably benign	Het
Mettl16	T	A	11: 74,816,940	V320E	probably benign	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nup188	T	A	2: 30,304,131	D149E	probably damaging	Het
Ogfrl1	A	G	1: 23,379,049	S83P	probably damaging	Het
Olfr1025-ps1	T	A	2: 85,918,136	D70E	probably damaging	Het
Olfr1083-ps	T	A	2: 86,607,020	I184F	unknown	Het
Olfr1154	T	C	2: 87,903,571	Y35C	probably damaging	Het
Olfr685	T	A	7: 105,180,572	H262L	probably damaging	Het
Pafah1b3	C	T	7: 25,295,339	R98Q	probably damaging	Het
Pde6b	A	T	5: 108,423,491	K437*	probably null	Het
Ppp1r12b	A	T	1: 134,834,392		probably benign	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Prdm9	T	C	17: 15,562,417	Q104R	possibly damaging	Het
Rgs22	A	T	15: 36,050,245		probably null	Het
Rnf14	C	T	18: 38,308,388	P277L	probably damaging	Het
Robo4	T	C	9: 37,404,806	S258P	probably benign	Het
Sfrp1	T	A	8: 23,417,404	F207I	probably damaging	Het
Sgms1	A	G	19: 32,159,687	S160P	probably damaging	Het
Sil1	T	C	18: 35,269,702	K263R	probably benign	Het
St14	A	G	9: 31,097,551		probably null	Het
Syne2	A	G	12: 75,909,131		probably benign	Het
Tbc1d9	T	C	8: 83,269,206	S1013P	probably benign	Het
Tmem67	T	C	4: 12,070,471	S352G	probably benign	Het
Trib2	C	A	12: 15,793,794	K282N	possibly damaging	Het
Trnau1ap	T	C	4: 132,327,171		probably benign	Het
Trpm4	T	C	7: 45,308,630	D952G	probably damaging	Het
Unc93b1	A	G	19: 3,942,762	N305D	possibly damaging	Het
Usp32	A	G	11: 85,026,795	V802A	probably benign	Het
Vmn2r48	T	A	7: 9,942,324	H410L	probably damaging	Het
Wfs1	T	C	5: 36,975,587	N116S	probably benign	Het
Wif1	A	T	10: 121,099,779	H333L	probably benign	Het
Zfp109	T	C	7: 24,228,737	T416A	possibly damaging	Het
Zfp808	T	A	13: 62,172,630	C558S	probably damaging	Het
Zpbp	T	C	11: 11,459,734	D116G	possibly damaging	Het

Other mutations in Kcnd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02296:Kcnd3	APN	3	105667001	nonsense	probably null
PIT4498001:Kcnd3	UTSW	3	105658709	missense	probably damaging	0.99
R0483:Kcnd3	UTSW	3	105459626	missense	probably damaging	1.00
R0544:Kcnd3	UTSW	3	105658759	missense	probably damaging	1.00
R1457:Kcnd3	UTSW	3	105668186	missense	probably benign	0.00
R1853:Kcnd3	UTSW	3	105459752	missense	probably damaging	1.00
R2030:Kcnd3	UTSW	3	105459537	missense	probably damaging	1.00
R2077:Kcnd3	UTSW	3	105666999	missense	probably benign	0.16
R2106:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2287:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2288:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2316:Kcnd3	UTSW	3	105669126	missense	probably benign	0.17
R2909:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2924:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2925:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3014:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3016:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3038:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3696:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3697:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3698:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3777:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3778:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3785:Kcnd3	UTSW	3	105668225	missense	possibly damaging	0.79
R3810:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3811:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3815:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3816:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3819:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3877:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3879:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3899:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4300:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4367:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4370:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4491:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4549:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4550:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4569:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4571:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4593:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4594:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4595:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4624:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4625:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4627:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4630:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4631:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4632:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4799:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4822:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R5021:Kcnd3	UTSW	3	105658754	missense	probably damaging	1.00
R5849:Kcnd3	UTSW	3	105458795	utr 5 prime	probably benign
R7198:Kcnd3	UTSW	3	105459540	missense	probably damaging	1.00
R7224:Kcnd3	UTSW	3	105669084	missense	probably damaging	0.98
R7532:Kcnd3	UTSW	3	105668210	missense	probably damaging	1.00
R7578:Kcnd3	UTSW	3	105459617	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- ATGCCAGGTTCTAGGGAAGG -3'
(R):5'- AGCCCAGGAAGAATCAGTTGC -3'

Sequencing Primer
(F):5'- TTCTAGGGAAGGAATGTAGGACCC -3'
(R):5'- CCCAGGAAGAATCAGTTGCACATG -3'

Posted On

2016-06-06