Incidental Mutation 'R5056:Map6'
ID 390845
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms F-STOP, Mtap6, 2810411E12Rik, STOP
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock # R5056 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 99267447-99337137 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99336652 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 588 (F588L)
Ref Sequence ENSEMBL: ENSMUSP00000146954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably benign
Transcript: ENSMUST00000068973
AA Change: F791L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: F791L

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000207883
AA Change: F791L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably benign
Transcript: ENSMUST00000208924
AA Change: F588L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0118:Map6 UTSW 7 99317617 missense possibly damaging 0.53
R0125:Map6 UTSW 7 99335980 splice site probably null
R0244:Map6 UTSW 7 99336836 missense probably benign 0.00
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0974:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R1455:Map6 UTSW 7 99268214 missense probably damaging 1.00
R1678:Map6 UTSW 7 99268098 missense probably damaging 1.00
R1696:Map6 UTSW 7 99317457 splice site probably null
R1866:Map6 UTSW 7 99315876 missense probably damaging 1.00
R2061:Map6 UTSW 7 99317472 missense probably damaging 1.00
R3236:Map6 UTSW 7 99336824 missense probably damaging 1.00
R3625:Map6 UTSW 7 99269195 missense possibly damaging 0.60
R4044:Map6 UTSW 7 99268049 missense probably damaging 1.00
R4570:Map6 UTSW 7 99336556 missense possibly damaging 0.49
R5065:Map6 UTSW 7 99336710 missense probably benign 0.02
R5656:Map6 UTSW 7 99336298 missense probably damaging 1.00
R6101:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6105:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6302:Map6 UTSW 7 99336107 missense probably damaging 0.99
R6450:Map6 UTSW 7 99268038 missense probably damaging 1.00
R6915:Map6 UTSW 7 99268247 missense probably damaging 1.00
R7205:Map6 UTSW 7 99269050 missense probably benign 0.00
R7223:Map6 UTSW 7 99268025 missense probably damaging 1.00
R7293:Map6 UTSW 7 99336533 missense possibly damaging 0.49
R7481:Map6 UTSW 7 99269138 missense possibly damaging 0.57
R7489:Map6 UTSW 7 99268061 missense probably damaging 1.00
R7691:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7693:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7695:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R8341:Map6 UTSW 7 99268440 missense possibly damaging 0.75
R8865:Map6 UTSW 7 99268985 missense probably benign 0.37
R8953:Map6 UTSW 7 99315871 missense probably damaging 1.00
R9108:Map6 UTSW 7 99336896 missense probably damaging 1.00
R9173:Map6 UTSW 7 99268728 missense probably damaging 1.00
R9613:Map6 UTSW 7 99269177 missense possibly damaging 0.90
R9654:Map6 UTSW 7 99336959 missense probably damaging 1.00
Z1176:Map6 UTSW 7 99317660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTAAGGATCAAAGCTTCCC -3'
(R):5'- CTGACCCTTCAAAGGTACTGG -3'

Sequencing Primer
(F):5'- GAGAAGGATCGAGCTCCCAC -3'
(R):5'- CCCTTCAAAGGTACTGGGATTATAGG -3'
Posted On 2016-06-06