Mutagenetix > Incidental Mutation

Incidental Mutation 'R5056:Cnot1'

390850

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

042646-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5056 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95741008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1499 (N1499S)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068452
AA Change: N1494S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: N1494S

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098473
AA Change: N1499S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: N1499S

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211887
AA Change: N1492S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000211973

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212340

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212712

Predicted Effect

probably damaging
Transcript: ENSMUST00000213006
AA Change: N1499S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.5002

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.2%

Validation Efficiency

99% (73/74)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030J22Rik	T	A	8: 116,971,682	K229*	probably null	Het
9930021J03Rik	A	T	19: 29,717,359	I1578K	probably benign	Het
Adora2a	T	A	10: 75,326,158	S44T	probably damaging	Het
Agap3	T	C	5: 24,477,862	V459A	probably damaging	Het
Apc2	T	C	10: 80,301,314	V31A	probably benign	Het
Asic2	T	A	11: 80,971,603	K189N	possibly damaging	Het
Bbs10	C	T	10: 111,300,540	P505S	probably benign	Het
C87414	T	C	5: 93,638,925		probably benign	Het
Cdh20	G	T	1: 104,953,997	V396L	probably benign	Het
Cenpb	C	T	2: 131,178,171		probably benign	Het
Chil6	T	A	3: 106,394,343	Y147F	probably damaging	Het
Cluh	C	T	11: 74,661,946	R606C	probably damaging	Het
Cmtr1	A	G	17: 29,690,328	T404A	possibly damaging	Het
Dmkn	T	C	7: 30,764,104	S61P	probably damaging	Het
Dmxl1	T	C	18: 49,870,923	C872R	probably benign	Het
Dnah3	A	G	7: 120,020,946	Y1587H	probably damaging	Het
Dsc2	A	T	18: 20,050,142	V73D	probably damaging	Het
F5	A	T	1: 164,192,032	Y692F	possibly damaging	Het
Fam184a	A	T	10: 53,674,574	L80I	probably damaging	Het
Fam46b	C	T	4: 133,480,438	R47W	possibly damaging	Het
Foxj2	A	G	6: 122,833,874	H271R	probably benign	Het
Grm7	A	G	6: 111,080,443	T335A	probably damaging	Het
Hspa9	A	G	18: 34,938,681	L622P	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kcnd3	T	A	3: 105,666,928		probably benign	Het
Klhdc8b	ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC	ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC	9: 108,448,985		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrch4	C	G	5: 137,636,851	N237K	probably damaging	Het
Lss	T	G	10: 76,552,926		probably null	Het
Map6	T	C	7: 99,336,652	F588L	probably benign	Het
Mbd6	C	T	10: 127,286,441	V173I	probably benign	Het
Med13	A	T	11: 86,328,565	S352T	probably benign	Het
Mettl16	T	A	11: 74,816,940	V320E	probably benign	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nup188	T	A	2: 30,304,131	D149E	probably damaging	Het
Ogfrl1	A	G	1: 23,379,049	S83P	probably damaging	Het
Olfr1025-ps1	T	A	2: 85,918,136	D70E	probably damaging	Het
Olfr1083-ps	T	A	2: 86,607,020	I184F	unknown	Het
Olfr1154	T	C	2: 87,903,571	Y35C	probably damaging	Het
Olfr685	T	A	7: 105,180,572	H262L	probably damaging	Het
Pafah1b3	C	T	7: 25,295,339	R98Q	probably damaging	Het
Pde6b	A	T	5: 108,423,491	K437*	probably null	Het
Ppp1r12b	A	T	1: 134,834,392		probably benign	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Prdm9	T	C	17: 15,562,417	Q104R	possibly damaging	Het
Rgs22	A	T	15: 36,050,245		probably null	Het
Rnf14	C	T	18: 38,308,388	P277L	probably damaging	Het
Robo4	T	C	9: 37,404,806	S258P	probably benign	Het
Sfrp1	T	A	8: 23,417,404	F207I	probably damaging	Het
Sgms1	A	G	19: 32,159,687	S160P	probably damaging	Het
Sil1	T	C	18: 35,269,702	K263R	probably benign	Het
St14	A	G	9: 31,097,551		probably null	Het
Syne2	A	G	12: 75,909,131		probably benign	Het
Tbc1d9	T	C	8: 83,269,206	S1013P	probably benign	Het
Tmem67	T	C	4: 12,070,471	S352G	probably benign	Het
Trib2	C	A	12: 15,793,794	K282N	possibly damaging	Het
Trnau1ap	T	C	4: 132,327,171		probably benign	Het
Trpm4	T	C	7: 45,308,630	D952G	probably damaging	Het
Unc93b1	A	G	19: 3,942,762	N305D	possibly damaging	Het
Usp32	A	G	11: 85,026,795	V802A	probably benign	Het
Vmn2r48	T	A	7: 9,942,324	H410L	probably damaging	Het
Wfs1	T	C	5: 36,975,587	N116S	probably benign	Het
Wif1	A	T	10: 121,099,779	H333L	probably benign	Het
Zfp109	T	C	7: 24,228,737	T416A	possibly damaging	Het
Zfp808	T	A	13: 62,172,630	C558S	probably damaging	Het
Zpbp	T	C	11: 11,459,734	D116G	possibly damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- CAGGATCACAGTACCTACGTCC -3'
(R):5'- TCTGCTGGTACATAGGTAGTACCAG -3'

Sequencing Primer
(F):5'- GGATCACAGTACCTACGTCCTTCTTG -3'
(R):5'- CAGAATATGGAATGACCTGTTGACC -3'

Posted On

2016-06-06