Incidental Mutation 'R5056:St14'
ID390852
Institutional Source Beutler Lab
Gene Symbol St14
Ensembl Gene ENSMUSG00000031995
Gene Namesuppression of tumorigenicity 14 (colon carcinoma)
SynonymsMT-SP1, matriptase, Tmprss14, Prss14, Epithin
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5056 (G1)
Quality Score199
Status Validated
Chromosome9
Chromosomal Location31089402-31131853 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 31097551 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034478]
Predicted Effect probably null
Transcript: ENSMUST00000034478
SMART Domains Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
Pfam:SEA 88 181 7.9e-17 PFAM
CUB 214 334 4.24e-14 SMART
CUB 340 447 4.37e-25 SMART
LDLa 452 486 2.31e-9 SMART
LDLa 487 523 4.08e-10 SMART
LDLa 524 561 3.98e-13 SMART
LDLa 566 604 1.48e-7 SMART
Tryp_SPc 614 849 1.25e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217404
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in St14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:St14 APN 9 31103779 missense probably damaging 1.00
IGL01443:St14 APN 9 31100193 nonsense probably null
IGL01816:St14 APN 9 31108267 missense possibly damaging 0.71
IGL02100:St14 APN 9 31100130 splice site probably benign
IGL02494:St14 APN 9 31108645 missense possibly damaging 0.47
IGL02588:St14 APN 9 31090033 splice site probably benign
IGL02663:St14 APN 9 31100382 splice site probably null
IGL02711:St14 APN 9 31089900 missense probably benign 0.05
IGL03130:St14 APN 9 31097071 critical splice donor site probably null
IGL03296:St14 APN 9 31108712 missense probably damaging 0.98
IGL03400:St14 APN 9 31096971 splice site probably benign
R0101:St14 UTSW 9 31097107 missense probably benign 0.23
R0225:St14 UTSW 9 31108284 critical splice acceptor site probably null
R0335:St14 UTSW 9 31091324 splice site probably benign
R0892:St14 UTSW 9 31100428 missense probably benign 0.38
R1334:St14 UTSW 9 31108210 missense probably damaging 1.00
R1487:St14 UTSW 9 31097180 missense probably damaging 1.00
R1521:St14 UTSW 9 31108215 missense probably benign 0.03
R1782:St14 UTSW 9 31100164 missense probably damaging 1.00
R1920:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1921:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1922:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1933:St14 UTSW 9 31106212 missense probably benign 0.00
R2070:St14 UTSW 9 31091373 missense probably damaging 1.00
R2411:St14 UTSW 9 31108234 missense probably benign 0.13
R4152:St14 UTSW 9 31090506 missense probably benign 0.08
R4375:St14 UTSW 9 31090458 missense probably benign 0.02
R4419:St14 UTSW 9 31096928 missense probably damaging 1.00
R4747:St14 UTSW 9 31103757 missense possibly damaging 0.78
R4791:St14 UTSW 9 31095622 missense probably benign 0.27
R4915:St14 UTSW 9 31108664 nonsense probably null
R5134:St14 UTSW 9 31095583 missense probably benign 0.00
R5241:St14 UTSW 9 31100418 nonsense probably null
R5325:St14 UTSW 9 31096978 splice site probably null
R5644:St14 UTSW 9 31106510 missense probably benign
R5828:St14 UTSW 9 31091507 missense probably damaging 1.00
R5922:St14 UTSW 9 31129904 intron probably benign
R5930:St14 UTSW 9 31103760 missense probably damaging 1.00
R5963:St14 UTSW 9 31106557 intron probably benign
R6911:St14 UTSW 9 31106785 missense probably benign 0.00
R6937:St14 UTSW 9 31129660 intron probably null
R6986:St14 UTSW 9 31096549 missense probably damaging 0.98
R7226:St14 UTSW 9 31100152 missense possibly damaging 0.63
R7395:St14 UTSW 9 31096899 missense probably benign 0.29
R7400:St14 UTSW 9 31108275 missense probably benign 0.36
Z1177:St14 UTSW 9 31090507 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGATTCCCAATGGCGTGG -3'
(R):5'- GCTGTGAGATGACTGCTAGG -3'

Sequencing Primer
(F):5'- CCAATGGCGTGGGCTGG -3'
(R):5'- CTGTGAGATGACTGCTAGGGAAAAG -3'
Posted On2016-06-06