Incidental Mutation 'R5056:Fam184a'
ID390855
Institutional Source Beutler Lab
Gene Symbol Fam184a
Ensembl Gene ENSMUSG00000019856
Gene Namefamily with sequence similarity 184, member A
Synonyms4930438C08Rik, 4930589M24Rik, 3110012E06Rik
MMRRC Submission 042646-MU
Accession Numbers

Genbank: NM_001081428; MGI: 1923156

Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R5056 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53633145-53751123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53674574 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 80 (L80I)
Ref Sequence ENSEMBL: ENSMUSP00000151789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020003] [ENSMUST00000163761] [ENSMUST00000171807] [ENSMUST00000218682]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020003
AA Change: L697I

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020003
Gene: ENSMUSG00000019856
AA Change: L697I

DomainStartEndE-ValueType
Pfam:FAM184 57 267 1.5e-84 PFAM
low complexity region 436 449 N/A INTRINSIC
Blast:HisKA 533 598 4e-6 BLAST
coiled coil region 656 788 N/A INTRINSIC
internal_repeat_2 795 864 2.49e-6 PROSPERO
internal_repeat_1 800 866 4.75e-7 PROSPERO
coiled coil region 960 983 N/A INTRINSIC
low complexity region 1101 1113 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163761
AA Change: L641I

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127400
Gene: ENSMUSG00000019856
AA Change: L641I

DomainStartEndE-ValueType
coiled coil region 4 88 N/A INTRINSIC
internal_repeat_1 99 167 6.86e-8 PROSPERO
internal_repeat_2 105 173 4e-7 PROSPERO
low complexity region 380 393 N/A INTRINSIC
Blast:HisKA 480 542 5e-6 BLAST
coiled coil region 600 732 N/A INTRINSIC
internal_repeat_2 739 808 4e-7 PROSPERO
internal_repeat_1 744 810 6.86e-8 PROSPERO
low complexity region 906 916 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168949
Predicted Effect probably damaging
Transcript: ENSMUST00000171807
AA Change: L293I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130315
Gene: ENSMUSG00000019856
AA Change: L293I

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
Pfam:DUF3090 64 159 5.9e-8 PFAM
low complexity region 303 343 N/A INTRINSIC
low complexity region 358 364 N/A INTRINSIC
internal_repeat_1 383 410 4.35e-5 PROSPERO
internal_repeat_1 424 451 4.35e-5 PROSPERO
low complexity region 648 660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218682
AA Change: L80I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Fam184a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Fam184a APN 10 53694686 splice site probably benign
IGL01448:Fam184a APN 10 53698949 missense probably benign 0.19
IGL02052:Fam184a APN 10 53697120 unclassified probably benign
IGL02086:Fam184a APN 10 53699255 missense probably damaging 1.00
IGL02163:Fam184a APN 10 53647134 splice site probably null
IGL02247:Fam184a APN 10 53675160 missense probably damaging 1.00
IGL02316:Fam184a APN 10 53638239 missense probably damaging 1.00
IGL02493:Fam184a APN 10 53694693 critical splice donor site probably null
IGL02629:Fam184a APN 10 53698811 missense possibly damaging 0.80
IGL03006:Fam184a APN 10 53698697 missense probably damaging 1.00
2107:Fam184a UTSW 10 53641057 missense probably damaging 1.00
PIT4802001:Fam184a UTSW 10 53684354 nonsense probably null
R0427:Fam184a UTSW 10 53690115 missense probably damaging 1.00
R0477:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R0511:Fam184a UTSW 10 53698879 missense probably benign 0.03
R1322:Fam184a UTSW 10 53652319 missense probably damaging 1.00
R1422:Fam184a UTSW 10 53675208 missense probably benign 0.29
R1474:Fam184a UTSW 10 53635365 missense probably damaging 0.99
R1752:Fam184a UTSW 10 53674570 missense probably benign 0.02
R1831:Fam184a UTSW 10 53647084 missense probably damaging 0.97
R2186:Fam184a UTSW 10 53638194 missense probably damaging 1.00
R2202:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2203:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2221:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2223:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2261:Fam184a UTSW 10 53647570 critical splice donor site probably null
R2444:Fam184a UTSW 10 53640949 missense probably damaging 1.00
R3876:Fam184a UTSW 10 53699061 missense probably damaging 1.00
R3932:Fam184a UTSW 10 53699301 missense probably damaging 0.99
R4685:Fam184a UTSW 10 53698500 missense probably benign 0.39
R4953:Fam184a UTSW 10 53698805 missense probably benign 0.00
R5420:Fam184a UTSW 10 53633657 missense probably damaging 0.99
R6159:Fam184a UTSW 10 53698773 missense probably damaging 1.00
R6554:Fam184a UTSW 10 53640967 missense possibly damaging 0.95
R6714:Fam184a UTSW 10 53698883 missense probably benign 0.00
R6966:Fam184a UTSW 10 53654999 missense probably benign 0.34
R7034:Fam184a UTSW 10 53694814 missense possibly damaging 0.71
R7237:Fam184a UTSW 10 53634393 unclassified probably benign
R7253:Fam184a UTSW 10 53698805 missense probably benign 0.00
R7359:Fam184a UTSW 10 53699222 missense probably damaging 1.00
R7449:Fam184a UTSW 10 53698634 missense probably damaging 0.98
R7479:Fam184a UTSW 10 53655014 missense probably benign 0.01
R7725:Fam184a UTSW 10 53633706 nonsense probably null
R7726:Fam184a UTSW 10 53633706 nonsense probably null
R7881:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7886:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7896:Fam184a UTSW 10 53633706 nonsense probably null
R7897:Fam184a UTSW 10 53633706 nonsense probably null
R7964:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7969:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7979:Fam184a UTSW 10 53633706 nonsense probably null
R7980:Fam184a UTSW 10 53633706 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTAGCAGACTGTTTCCTGTGAC -3'
(R):5'- CTTTTAGAAACCCTGTGAGCCC -3'

Sequencing Primer
(F):5'- AGACTGTTTCCTGTGACTATGTTTC -3'
(R):5'- CCCAGAGAGCATTTCCTGAGAG -3'
Posted On2016-06-06