Incidental Mutation 'R5056:Bbs10'
ID390858
Institutional Source Beutler Lab
Gene Symbol Bbs10
Ensembl Gene ENSMUSG00000035759
Gene NameBardet-Biedl syndrome 10 (human)
Synonyms
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5056 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location111298679-111301727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111300540 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 505 (P505S)
Ref Sequence ENSEMBL: ENSMUSP00000049387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040454] [ENSMUST00000105275]
Predicted Effect probably benign
Transcript: ENSMUST00000040454
AA Change: P505S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049387
Gene: ENSMUSG00000035759
AA Change: P505S

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 17 103 3.6e-15 PFAM
Pfam:Cpn60_TCP1 139 427 1.1e-7 PFAM
SCOP:d1a6da1 567 695 3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105275
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219990
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by progressive retinal degeneration, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene is likely not a ciliary protein but rather has distant sequence homology to type II chaperonins. As a molecular chaperone, this protein may affect the folding or stability of other ciliary or basal body proteins. Inhibition of this protein's expression impairs ciliogenesis in preadipocytes. Mutations in this gene cause Bardet-Biedl syndrome type 10. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop obesity, hyperleptinemia, retinal degeneration, structural defects in renal glomeruli, microalbuminuria, polyuria, increased circulating antidiuretic hormone levels, and vacuolated renal epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Bbs10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Bbs10 UTSW 10 111298844 missense probably damaging 1.00
R0117:Bbs10 UTSW 10 111299333 missense possibly damaging 0.94
R0189:Bbs10 UTSW 10 111301065 missense probably damaging 1.00
R0373:Bbs10 UTSW 10 111300052 missense probably damaging 1.00
R0761:Bbs10 UTSW 10 111299383 missense probably damaging 1.00
R1319:Bbs10 UTSW 10 111298874 missense probably damaging 1.00
R1986:Bbs10 UTSW 10 111299257 missense probably damaging 1.00
R2015:Bbs10 UTSW 10 111300855 nonsense probably null
R2361:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3716:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3717:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4407:Bbs10 UTSW 10 111299859 missense probably benign 0.00
R4583:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4607:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4607:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4608:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4608:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4609:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4646:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4647:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4648:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4730:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4822:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4832:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R6285:Bbs10 UTSW 10 111299761 missense probably damaging 1.00
R6604:Bbs10 UTSW 10 111301104 missense possibly damaging 0.51
R7120:Bbs10 UTSW 10 111299449 missense possibly damaging 0.74
R7174:Bbs10 UTSW 10 111300767 nonsense probably null
R7376:Bbs10 UTSW 10 111299250 missense probably benign 0.08
R7701:Bbs10 UTSW 10 111300013 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCAAGTCCTCTTGCTTATGAC -3'
(R):5'- TAGTGACTTGCGCATCACTG -3'

Sequencing Primer
(F):5'- CTTGCTTATGACAATAGCAGAGAGC -3'
(R):5'- ATCACTGGCAGCGTGTAAC -3'
Posted On2016-06-06