Incidental Mutation 'R5056:Asic2'
ID390863
Institutional Source Beutler Lab
Gene Symbol Asic2
Ensembl Gene ENSMUSG00000020704
Gene Nameacid-sensing (proton-gated) ion channel 2
SynonymsMdeg, BNC1, BNaC1a, Accn1
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5056 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80880169-81968457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80971603 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 189 (K189N)
Ref Sequence ENSEMBL: ENSMUSP00000067095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021045] [ENSMUST00000066197]
Predicted Effect probably benign
Transcript: ENSMUST00000021045
AA Change: K240N

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021045
Gene: ENSMUSG00000020704
AA Change: K240N

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
Pfam:ASC 61 504 6.7e-94 PFAM
low complexity region 507 523 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066197
AA Change: K189N

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067095
Gene: ENSMUSG00000020704
AA Change: K189N

DomainStartEndE-ValueType
Pfam:ASC 20 454 3.3e-177 PFAM
low complexity region 456 472 N/A INTRINSIC
Meta Mutation Damage Score 0.2199 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mechanoreceptor and spiral ganglion electrophysiology and decreased pressure-induced blood vessel constriction. Mice homozygous for a different knock-out allele exhibit retinal degeneration and abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Asic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Asic2 APN 11 80894030 missense probably damaging 0.99
IGL02420:Asic2 APN 11 80881653 missense probably benign 0.05
IGL02451:Asic2 APN 11 80891737 splice site probably benign
LCD18:Asic2 UTSW 11 80985744 intron probably benign
R0682:Asic2 UTSW 11 80886680 missense possibly damaging 0.67
R0718:Asic2 UTSW 11 80971456 splice site probably benign
R0784:Asic2 UTSW 11 80893989 missense possibly damaging 0.92
R2679:Asic2 UTSW 11 81151954 missense probably benign 0.13
R2883:Asic2 UTSW 11 80894013 missense possibly damaging 0.61
R2991:Asic2 UTSW 11 81968037 missense probably benign
R4722:Asic2 UTSW 11 81968183 start codon destroyed probably null 0.00
R4770:Asic2 UTSW 11 80971492 missense probably benign 0.07
R4900:Asic2 UTSW 11 81573454 intron probably benign
R5005:Asic2 UTSW 11 80883426 missense probably damaging 1.00
R5344:Asic2 UTSW 11 80971587 missense probably damaging 1.00
R5490:Asic2 UTSW 11 80889820 missense probably benign 0.02
R5722:Asic2 UTSW 11 81967980 missense probably benign 0.07
R6072:Asic2 UTSW 11 80894088 missense probably damaging 0.97
R6589:Asic2 UTSW 11 80886604 missense possibly damaging 0.79
R7068:Asic2 UTSW 11 81152255 missense probably benign 0.01
R7226:Asic2 UTSW 11 80971514 missense probably damaging 1.00
R7593:Asic2 UTSW 11 81967831 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGCCTTTCTGAGGGAAAC -3'
(R):5'- GTGGAGAGATCACACACCATC -3'

Sequencing Primer
(F):5'- GGAAACCTACATCTATTACCACCC -3'
(R):5'- GATCACACACCATCCCAGTGGG -3'
Posted On2016-06-06