Incidental Mutation 'R5056:Med13'
ID 390865
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms 1110067M05Rik, Thrap1, Trap240
MMRRC Submission 042646-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R5056 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 86157859-86248422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86219391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 352 (S352T)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably benign
Transcript: ENSMUST00000043624
AA Change: S352T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: S352T

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157605
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 117,698,421 (GRCm39) K229* probably null Het
Adora2a T A 10: 75,161,992 (GRCm39) S44T probably damaging Het
Agap3 T C 5: 24,682,860 (GRCm39) V459A probably damaging Het
Apc2 T C 10: 80,137,148 (GRCm39) V31A probably benign Het
Asic2 T A 11: 80,862,429 (GRCm39) K189N possibly damaging Het
Bbs10 C T 10: 111,136,401 (GRCm39) P505S probably benign Het
Brd10 A T 19: 29,694,759 (GRCm39) I1578K probably benign Het
Cdh20 G T 1: 104,881,722 (GRCm39) V396L probably benign Het
Cenpb C T 2: 131,020,091 (GRCm39) probably benign Het
Chil6 T A 3: 106,301,659 (GRCm39) Y147F probably damaging Het
Cluh C T 11: 74,552,772 (GRCm39) R606C probably damaging Het
Cmtr1 A G 17: 29,909,302 (GRCm39) T404A possibly damaging Het
Cnot1 T C 8: 96,467,636 (GRCm39) N1499S probably damaging Het
Dmkn T C 7: 30,463,529 (GRCm39) S61P probably damaging Het
Dmxl1 T C 18: 50,003,990 (GRCm39) C872R probably benign Het
Dnah3 A G 7: 119,620,169 (GRCm39) Y1587H probably damaging Het
Dsc2 A T 18: 20,183,199 (GRCm39) V73D probably damaging Het
F5 A T 1: 164,019,601 (GRCm39) Y692F possibly damaging Het
Fam184a A T 10: 53,550,670 (GRCm39) L80I probably damaging Het
Foxj2 A G 6: 122,810,833 (GRCm39) H271R probably benign Het
Grm7 A G 6: 111,057,404 (GRCm39) T335A probably damaging Het
Hspa9 A G 18: 35,071,734 (GRCm39) L622P probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kcnd3 T A 3: 105,574,244 (GRCm39) probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,326,184 (GRCm39) probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lrch4 C G 5: 137,635,113 (GRCm39) N237K probably damaging Het
Lss T G 10: 76,388,760 (GRCm39) probably null Het
Map6 T C 7: 98,985,859 (GRCm39) F588L probably benign Het
Mbd6 C T 10: 127,122,310 (GRCm39) V173I probably benign Het
Mettl16 T A 11: 74,707,766 (GRCm39) V320E probably benign Het
Myh7b G C 2: 155,474,293 (GRCm39) R1669S possibly damaging Het
Nup188 T A 2: 30,194,143 (GRCm39) D149E probably damaging Het
Ogfrl1 A G 1: 23,418,130 (GRCm39) S83P probably damaging Het
Or52l1 T A 7: 104,829,779 (GRCm39) H262L probably damaging Het
Or5m13 T A 2: 85,748,480 (GRCm39) D70E probably damaging Het
Or8k36-ps1 T A 2: 86,437,364 (GRCm39) I184F unknown Het
Or9m1 T C 2: 87,733,915 (GRCm39) Y35C probably damaging Het
Pafah1b3 C T 7: 24,994,764 (GRCm39) R98Q probably damaging Het
Pde6b A T 5: 108,571,357 (GRCm39) K437* probably null Het
Ppp1r12b A T 1: 134,762,130 (GRCm39) probably benign Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Pramel34 T C 5: 93,786,784 (GRCm39) probably benign Het
Prdm9 T C 17: 15,782,679 (GRCm39) Q104R possibly damaging Het
Rgs22 A T 15: 36,050,391 (GRCm39) probably null Het
Rnf14 C T 18: 38,441,441 (GRCm39) P277L probably damaging Het
Robo4 T C 9: 37,316,102 (GRCm39) S258P probably benign Het
Sfrp1 T A 8: 23,907,420 (GRCm39) F207I probably damaging Het
Sgms1 A G 19: 32,137,087 (GRCm39) S160P probably damaging Het
Sil1 T C 18: 35,402,755 (GRCm39) K263R probably benign Het
St14 A G 9: 31,008,847 (GRCm39) probably null Het
Syne2 A G 12: 75,955,905 (GRCm39) probably benign Het
Tbc1d9 T C 8: 83,995,835 (GRCm39) S1013P probably benign Het
Tent5b C T 4: 133,207,749 (GRCm39) R47W possibly damaging Het
Tmem67 T C 4: 12,070,471 (GRCm39) S352G probably benign Het
Trib2 C A 12: 15,843,795 (GRCm39) K282N possibly damaging Het
Trnau1ap T C 4: 132,054,482 (GRCm39) probably benign Het
Trpm4 T C 7: 44,958,054 (GRCm39) D952G probably damaging Het
Unc93b1 A G 19: 3,992,762 (GRCm39) N305D possibly damaging Het
Usp32 A G 11: 84,917,621 (GRCm39) V802A probably benign Het
Vmn2r48 T A 7: 9,676,251 (GRCm39) H410L probably damaging Het
Wfs1 T C 5: 37,132,931 (GRCm39) N116S probably benign Het
Wif1 A T 10: 120,935,684 (GRCm39) H333L probably benign Het
Zfp109 T C 7: 23,928,162 (GRCm39) T416A possibly damaging Het
Zfp808 T A 13: 62,320,444 (GRCm39) C558S probably damaging Het
Zpbp T C 11: 11,409,734 (GRCm39) D116G possibly damaging Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86,181,866 (GRCm39) splice site probably benign
IGL01391:Med13 APN 11 86,219,323 (GRCm39) missense probably benign
IGL01767:Med13 APN 11 86,210,609 (GRCm39) missense probably benign 0.38
IGL01830:Med13 APN 11 86,179,754 (GRCm39) splice site probably benign
IGL01859:Med13 APN 11 86,174,577 (GRCm39) missense possibly damaging 0.86
IGL01924:Med13 APN 11 86,199,522 (GRCm39) splice site probably benign
IGL02080:Med13 APN 11 86,174,638 (GRCm39) missense probably damaging 0.97
IGL02138:Med13 APN 11 86,177,591 (GRCm39) missense probably damaging 0.99
IGL02259:Med13 APN 11 86,248,327 (GRCm39) missense possibly damaging 0.89
IGL02339:Med13 APN 11 86,179,765 (GRCm39) missense probably benign 0.16
IGL02399:Med13 APN 11 86,174,771 (GRCm39) splice site probably benign
IGL02646:Med13 APN 11 86,174,212 (GRCm39) missense probably benign 0.00
IGL03227:Med13 APN 11 86,218,618 (GRCm39) splice site probably benign
R0197_Med13_854 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0360_Med13_060 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R2359_Med13_079 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R3735_Med13_085 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4974_Med13_508 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R0116:Med13 UTSW 11 86,210,723 (GRCm39) missense probably damaging 0.99
R0189:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R0197:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0206:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0208:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0310:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R0360:Med13 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R0413:Med13 UTSW 11 86,190,033 (GRCm39) splice site probably benign
R0482:Med13 UTSW 11 86,175,977 (GRCm39) missense probably benign 0.41
R0497:Med13 UTSW 11 86,167,809 (GRCm39) splice site probably benign
R0589:Med13 UTSW 11 86,174,075 (GRCm39) missense probably damaging 1.00
R0601:Med13 UTSW 11 86,236,788 (GRCm39) missense possibly damaging 0.47
R0646:Med13 UTSW 11 86,221,915 (GRCm39) missense possibly damaging 0.95
R0701:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0709:Med13 UTSW 11 86,210,422 (GRCm39) missense possibly damaging 0.95
R0711:Med13 UTSW 11 86,192,179 (GRCm39) splice site probably benign
R0734:Med13 UTSW 11 86,192,063 (GRCm39) missense probably benign
R0883:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R1793:Med13 UTSW 11 86,220,177 (GRCm39) missense probably benign 0.45
R1926:Med13 UTSW 11 86,179,899 (GRCm39) missense possibly damaging 0.47
R1959:Med13 UTSW 11 86,189,805 (GRCm39) missense probably damaging 1.00
R2286:Med13 UTSW 11 86,210,515 (GRCm39) missense probably benign 0.05
R2359:Med13 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R2444:Med13 UTSW 11 86,222,786 (GRCm39) missense probably damaging 1.00
R2679:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R2879:Med13 UTSW 11 86,189,988 (GRCm39) missense possibly damaging 0.61
R3439:Med13 UTSW 11 86,176,123 (GRCm39) missense probably damaging 1.00
R3735:Med13 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4333:Med13 UTSW 11 86,179,009 (GRCm39) missense probably benign
R4558:Med13 UTSW 11 86,189,880 (GRCm39) missense probably damaging 1.00
R4598:Med13 UTSW 11 86,169,392 (GRCm39) missense probably damaging 0.97
R4773:Med13 UTSW 11 86,167,746 (GRCm39) missense probably damaging 0.99
R4801:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4802:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4806:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R4940:Med13 UTSW 11 86,178,944 (GRCm39) missense probably damaging 1.00
R4974:Med13 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R5133:Med13 UTSW 11 86,210,675 (GRCm39) missense probably benign 0.32
R5206:Med13 UTSW 11 86,210,705 (GRCm39) missense probably damaging 1.00
R5352:Med13 UTSW 11 86,192,294 (GRCm39) missense possibly damaging 0.82
R5534:Med13 UTSW 11 86,210,191 (GRCm39) missense probably benign 0.09
R5556:Med13 UTSW 11 86,218,664 (GRCm39) missense probably benign 0.25
R5633:Med13 UTSW 11 86,169,757 (GRCm39) splice site probably benign
R5769:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R6236:Med13 UTSW 11 86,219,357 (GRCm39) missense probably damaging 0.99
R6479:Med13 UTSW 11 86,248,353 (GRCm39) start gained probably benign
R6487:Med13 UTSW 11 86,221,976 (GRCm39) missense probably damaging 1.00
R6524:Med13 UTSW 11 86,192,293 (GRCm39) missense probably damaging 0.98
R6528:Med13 UTSW 11 86,189,780 (GRCm39) missense probably damaging 1.00
R6805:Med13 UTSW 11 86,169,622 (GRCm39) missense possibly damaging 0.48
R6913:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R7221:Med13 UTSW 11 86,178,921 (GRCm39) missense probably benign 0.00
R7254:Med13 UTSW 11 86,210,661 (GRCm39) missense probably benign
R7267:Med13 UTSW 11 86,199,652 (GRCm39) missense probably benign 0.01
R7309:Med13 UTSW 11 86,181,888 (GRCm39) missense probably benign 0.00
R7404:Med13 UTSW 11 86,177,272 (GRCm39) missense possibly damaging 0.53
R7586:Med13 UTSW 11 86,161,828 (GRCm39) missense probably damaging 0.99
R7704:Med13 UTSW 11 86,236,744 (GRCm39) nonsense probably null
R7922:Med13 UTSW 11 86,161,831 (GRCm39) missense probably damaging 0.98
R7943:Med13 UTSW 11 86,169,352 (GRCm39) missense probably damaging 0.97
R8062:Med13 UTSW 11 86,210,264 (GRCm39) missense probably benign
R8075:Med13 UTSW 11 86,163,296 (GRCm39) missense probably damaging 0.98
R8207:Med13 UTSW 11 86,194,375 (GRCm39) missense probably damaging 1.00
R8671:Med13 UTSW 11 86,161,923 (GRCm39) missense probably damaging 1.00
R9056:Med13 UTSW 11 86,189,660 (GRCm39) nonsense probably null
R9084:Med13 UTSW 11 86,191,621 (GRCm39) missense probably damaging 1.00
R9148:Med13 UTSW 11 86,192,297 (GRCm39) missense probably benign 0.27
R9329:Med13 UTSW 11 86,189,283 (GRCm39) missense probably benign 0.10
R9380:Med13 UTSW 11 86,177,598 (GRCm39) missense probably benign 0.42
R9515:Med13 UTSW 11 86,199,727 (GRCm39) missense probably benign 0.00
R9516:Med13 UTSW 11 86,179,801 (GRCm39) missense probably benign 0.01
R9690:Med13 UTSW 11 86,169,670 (GRCm39) missense probably damaging 1.00
R9751:Med13 UTSW 11 86,189,984 (GRCm39) missense probably damaging 1.00
R9752:Med13 UTSW 11 86,174,147 (GRCm39) missense possibly damaging 0.87
R9764:Med13 UTSW 11 86,177,345 (GRCm39) missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86,246,249 (GRCm39) missense probably damaging 1.00
Z1176:Med13 UTSW 11 86,236,688 (GRCm39) missense probably benign 0.45
Z1176:Med13 UTSW 11 86,219,370 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCAGCATGCAAGTTTTAAATATCA -3'
(R):5'- AAATTTTGACCTCAGAATGTCACTAG -3'

Sequencing Primer
(F):5'- ATTTGATAGACCAGCCTCGG -3'
(R):5'- GACCTCAGAATGTCACTAGAATTAC -3'
Posted On 2016-06-06