Mutagenetix > Incidental Mutation

Incidental Mutation 'R5056:Dsc2'

390871

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

042646-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5056 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20050142 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 73 (V73D)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: V73D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: V73D

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: V73D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: V73D

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000128464
AA Change: V73D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331
AA Change: V73D

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.2%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030J22Rik	T	A	8: 116,971,682	K229*	probably null	Het
9930021J03Rik	A	T	19: 29,717,359	I1578K	probably benign	Het
Adora2a	T	A	10: 75,326,158	S44T	probably damaging	Het
Agap3	T	C	5: 24,477,862	V459A	probably damaging	Het
Apc2	T	C	10: 80,301,314	V31A	probably benign	Het
Asic2	T	A	11: 80,971,603	K189N	possibly damaging	Het
Bbs10	C	T	10: 111,300,540	P505S	probably benign	Het
C87414	T	C	5: 93,638,925		probably benign	Het
Cdh20	G	T	1: 104,953,997	V396L	probably benign	Het
Cenpb	C	T	2: 131,178,171		probably benign	Het
Chil6	T	A	3: 106,394,343	Y147F	probably damaging	Het
Cluh	C	T	11: 74,661,946	R606C	probably damaging	Het
Cmtr1	A	G	17: 29,690,328	T404A	possibly damaging	Het
Cnot1	T	C	8: 95,741,008	N1499S	probably damaging	Het
Dmkn	T	C	7: 30,764,104	S61P	probably damaging	Het
Dmxl1	T	C	18: 49,870,923	C872R	probably benign	Het
Dnah3	A	G	7: 120,020,946	Y1587H	probably damaging	Het
F5	A	T	1: 164,192,032	Y692F	possibly damaging	Het
Fam184a	A	T	10: 53,674,574	L80I	probably damaging	Het
Fam46b	C	T	4: 133,480,438	R47W	possibly damaging	Het
Foxj2	A	G	6: 122,833,874	H271R	probably benign	Het
Grm7	A	G	6: 111,080,443	T335A	probably damaging	Het
Hspa9	A	G	18: 34,938,681	L622P	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kcnd3	T	A	3: 105,666,928		probably benign	Het
Klhdc8b	ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC	ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC	9: 108,448,985		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrch4	C	G	5: 137,636,851	N237K	probably damaging	Het
Lss	T	G	10: 76,552,926		probably null	Het
Map6	T	C	7: 99,336,652	F588L	probably benign	Het
Mbd6	C	T	10: 127,286,441	V173I	probably benign	Het
Med13	A	T	11: 86,328,565	S352T	probably benign	Het
Mettl16	T	A	11: 74,816,940	V320E	probably benign	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nup188	T	A	2: 30,304,131	D149E	probably damaging	Het
Ogfrl1	A	G	1: 23,379,049	S83P	probably damaging	Het
Olfr1025-ps1	T	A	2: 85,918,136	D70E	probably damaging	Het
Olfr1083-ps	T	A	2: 86,607,020	I184F	unknown	Het
Olfr1154	T	C	2: 87,903,571	Y35C	probably damaging	Het
Olfr685	T	A	7: 105,180,572	H262L	probably damaging	Het
Pafah1b3	C	T	7: 25,295,339	R98Q	probably damaging	Het
Pde6b	A	T	5: 108,423,491	K437*	probably null	Het
Ppp1r12b	A	T	1: 134,834,392		probably benign	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Prdm9	T	C	17: 15,562,417	Q104R	possibly damaging	Het
Rgs22	A	T	15: 36,050,245		probably null	Het
Rnf14	C	T	18: 38,308,388	P277L	probably damaging	Het
Robo4	T	C	9: 37,404,806	S258P	probably benign	Het
Sfrp1	T	A	8: 23,417,404	F207I	probably damaging	Het
Sgms1	A	G	19: 32,159,687	S160P	probably damaging	Het
Sil1	T	C	18: 35,269,702	K263R	probably benign	Het
St14	A	G	9: 31,097,551		probably null	Het
Syne2	A	G	12: 75,909,131		probably benign	Het
Tbc1d9	T	C	8: 83,269,206	S1013P	probably benign	Het
Tmem67	T	C	4: 12,070,471	S352G	probably benign	Het
Trib2	C	A	12: 15,793,794	K282N	possibly damaging	Het
Trnau1ap	T	C	4: 132,327,171		probably benign	Het
Trpm4	T	C	7: 45,308,630	D952G	probably damaging	Het
Unc93b1	A	G	19: 3,942,762	N305D	possibly damaging	Het
Usp32	A	G	11: 85,026,795	V802A	probably benign	Het
Vmn2r48	T	A	7: 9,942,324	H410L	probably damaging	Het
Wfs1	T	C	5: 36,975,587	N116S	probably benign	Het
Wif1	A	T	10: 121,099,779	H333L	probably benign	Het
Zfp109	T	C	7: 24,228,737	T416A	possibly damaging	Het
Zfp808	T	A	13: 62,172,630	C558S	probably damaging	Het
Zpbp	T	C	11: 11,459,734	D116G	possibly damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTGTCAGTTAGCCCTAAAG -3'
(R):5'- TCACATGCCTTTATTTCAGGACAC -3'

Sequencing Primer
(F):5'- GTGTCAGTTAGCCCTAAAGAAACAC -3'
(R):5'- CATGCCTTTATTTCAGGACACATATC -3'

Posted On

2016-06-06