Incidental Mutation 'R5056:Dsc2'
ID 390871
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
MMRRC Submission 042646-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5056 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20183199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 73 (V73D)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably damaging
Transcript: ENSMUST00000039247
AA Change: V73D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: V73D

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075214
AA Change: V73D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: V73D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128464
AA Change: V73D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331
AA Change: V73D

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 117,698,421 (GRCm39) K229* probably null Het
Adora2a T A 10: 75,161,992 (GRCm39) S44T probably damaging Het
Agap3 T C 5: 24,682,860 (GRCm39) V459A probably damaging Het
Apc2 T C 10: 80,137,148 (GRCm39) V31A probably benign Het
Asic2 T A 11: 80,862,429 (GRCm39) K189N possibly damaging Het
Bbs10 C T 10: 111,136,401 (GRCm39) P505S probably benign Het
Brd10 A T 19: 29,694,759 (GRCm39) I1578K probably benign Het
Cdh20 G T 1: 104,881,722 (GRCm39) V396L probably benign Het
Cenpb C T 2: 131,020,091 (GRCm39) probably benign Het
Chil6 T A 3: 106,301,659 (GRCm39) Y147F probably damaging Het
Cluh C T 11: 74,552,772 (GRCm39) R606C probably damaging Het
Cmtr1 A G 17: 29,909,302 (GRCm39) T404A possibly damaging Het
Cnot1 T C 8: 96,467,636 (GRCm39) N1499S probably damaging Het
Dmkn T C 7: 30,463,529 (GRCm39) S61P probably damaging Het
Dmxl1 T C 18: 50,003,990 (GRCm39) C872R probably benign Het
Dnah3 A G 7: 119,620,169 (GRCm39) Y1587H probably damaging Het
F5 A T 1: 164,019,601 (GRCm39) Y692F possibly damaging Het
Fam184a A T 10: 53,550,670 (GRCm39) L80I probably damaging Het
Foxj2 A G 6: 122,810,833 (GRCm39) H271R probably benign Het
Grm7 A G 6: 111,057,404 (GRCm39) T335A probably damaging Het
Hspa9 A G 18: 35,071,734 (GRCm39) L622P probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kcnd3 T A 3: 105,574,244 (GRCm39) probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,326,184 (GRCm39) probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lrch4 C G 5: 137,635,113 (GRCm39) N237K probably damaging Het
Lss T G 10: 76,388,760 (GRCm39) probably null Het
Map6 T C 7: 98,985,859 (GRCm39) F588L probably benign Het
Mbd6 C T 10: 127,122,310 (GRCm39) V173I probably benign Het
Med13 A T 11: 86,219,391 (GRCm39) S352T probably benign Het
Mettl16 T A 11: 74,707,766 (GRCm39) V320E probably benign Het
Myh7b G C 2: 155,474,293 (GRCm39) R1669S possibly damaging Het
Nup188 T A 2: 30,194,143 (GRCm39) D149E probably damaging Het
Ogfrl1 A G 1: 23,418,130 (GRCm39) S83P probably damaging Het
Or52l1 T A 7: 104,829,779 (GRCm39) H262L probably damaging Het
Or5m13 T A 2: 85,748,480 (GRCm39) D70E probably damaging Het
Or8k36-ps1 T A 2: 86,437,364 (GRCm39) I184F unknown Het
Or9m1 T C 2: 87,733,915 (GRCm39) Y35C probably damaging Het
Pafah1b3 C T 7: 24,994,764 (GRCm39) R98Q probably damaging Het
Pde6b A T 5: 108,571,357 (GRCm39) K437* probably null Het
Ppp1r12b A T 1: 134,762,130 (GRCm39) probably benign Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Pramel34 T C 5: 93,786,784 (GRCm39) probably benign Het
Prdm9 T C 17: 15,782,679 (GRCm39) Q104R possibly damaging Het
Rgs22 A T 15: 36,050,391 (GRCm39) probably null Het
Rnf14 C T 18: 38,441,441 (GRCm39) P277L probably damaging Het
Robo4 T C 9: 37,316,102 (GRCm39) S258P probably benign Het
Sfrp1 T A 8: 23,907,420 (GRCm39) F207I probably damaging Het
Sgms1 A G 19: 32,137,087 (GRCm39) S160P probably damaging Het
Sil1 T C 18: 35,402,755 (GRCm39) K263R probably benign Het
St14 A G 9: 31,008,847 (GRCm39) probably null Het
Syne2 A G 12: 75,955,905 (GRCm39) probably benign Het
Tbc1d9 T C 8: 83,995,835 (GRCm39) S1013P probably benign Het
Tent5b C T 4: 133,207,749 (GRCm39) R47W possibly damaging Het
Tmem67 T C 4: 12,070,471 (GRCm39) S352G probably benign Het
Trib2 C A 12: 15,843,795 (GRCm39) K282N possibly damaging Het
Trnau1ap T C 4: 132,054,482 (GRCm39) probably benign Het
Trpm4 T C 7: 44,958,054 (GRCm39) D952G probably damaging Het
Unc93b1 A G 19: 3,992,762 (GRCm39) N305D possibly damaging Het
Usp32 A G 11: 84,917,621 (GRCm39) V802A probably benign Het
Vmn2r48 T A 7: 9,676,251 (GRCm39) H410L probably damaging Het
Wfs1 T C 5: 37,132,931 (GRCm39) N116S probably benign Het
Wif1 A T 10: 120,935,684 (GRCm39) H333L probably benign Het
Zfp109 T C 7: 23,928,162 (GRCm39) T416A possibly damaging Het
Zfp808 T A 13: 62,320,444 (GRCm39) C558S probably damaging Het
Zpbp T C 11: 11,409,734 (GRCm39) D116G possibly damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20,174,594 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,178,622 (GRCm39) missense probably benign 0.40
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7386:Dsc2 UTSW 18 20,174,983 (GRCm39) missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9487:Dsc2 UTSW 18 20,180,276 (GRCm39) missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGTCAGTTAGCCCTAAAG -3'
(R):5'- TCACATGCCTTTATTTCAGGACAC -3'

Sequencing Primer
(F):5'- GTGTCAGTTAGCCCTAAAGAAACAC -3'
(R):5'- CATGCCTTTATTTCAGGACACATATC -3'
Posted On 2016-06-06