Incidental Mutation 'R5056:Unc93b1'
ID 390876
Institutional Source Beutler Lab
Gene Symbol Unc93b1
Ensembl Gene ENSMUSG00000036908
Gene Name unc-93 homolog B1 (C. elegans)
Synonyms unc-93 homolog B, unc-93 related protein
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5056 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 3935186-3949340 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3942762 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 305 (N305D)
Ref Sequence ENSEMBL: ENSMUSP00000128751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162708] [ENSMUST00000165711]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161415
Predicted Effect probably benign
Transcript: ENSMUST00000162708
AA Change: N305D

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124272
Gene: ENSMUSG00000036908
AA Change: N305D

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 1.6e-8 PFAM
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 306 328 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
transmembrane domain 396 418 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
transmembrane domain 494 513 N/A INTRINSIC
transmembrane domain 518 535 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165711
AA Change: N305D

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128751
Gene: ENSMUSG00000036908
AA Change: N305D

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 5.1e-9 PFAM
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 305 327 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
Meta Mutation Damage Score 0.1031 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in innate and adaptive immune response by regulating toll-like receptor signaling. The encoded protein traffics nucleotide sensing toll-like receptors to the endolysosome from the endoplasmic reticulum. Deficiency of the encoded protein has been associated with herpes simplex encephalitis. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice with a transmembrane domain point mutation have no overt phenotype but fail to mount a normal cytokine response and exhibit increased susceptibility to mouse cytomegalovirus, Lysteria monocytogenes and Staphlococcus aureus. Antigen presentation by MHC class I and II is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Unc93b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Unc93b1 APN 19 3935356 splice site probably null
IGL02631:Unc93b1 APN 19 3942026 splice site probably benign
IGL02942:Unc93b1 APN 19 3948686 missense probably damaging 1.00
IGL03149:Unc93b1 APN 19 3944041 missense probably benign
3d UTSW 19 3944168 missense possibly damaging 0.96
novelty UTSW 19 3943632 missense probably damaging 1.00
speciality UTSW 19 3941910 missense possibly damaging 0.51
R0680:Unc93b1 UTSW 19 3947093 missense probably benign
R1237:Unc93b1 UTSW 19 3935228 missense possibly damaging 0.72
R1557:Unc93b1 UTSW 19 3942403 missense probably benign 0.13
R1992:Unc93b1 UTSW 19 3944062 missense probably benign 0.00
R2435:Unc93b1 UTSW 19 3936373 missense possibly damaging 0.89
R4016:Unc93b1 UTSW 19 3943572 missense probably damaging 1.00
R4080:Unc93b1 UTSW 19 3941959 missense probably damaging 0.99
R4479:Unc93b1 UTSW 19 3935236 missense probably benign 0.16
R4829:Unc93b1 UTSW 19 3944293 missense probably damaging 1.00
R4947:Unc93b1 UTSW 19 3935871 missense probably benign 0.05
R4964:Unc93b1 UTSW 19 3942023 splice site probably null
R4966:Unc93b1 UTSW 19 3942023 splice site probably null
R5166:Unc93b1 UTSW 19 3944027 missense probably damaging 1.00
R5441:Unc93b1 UTSW 19 3943703 missense probably benign 0.01
R5892:Unc93b1 UTSW 19 3943632 missense probably damaging 1.00
R6382:Unc93b1 UTSW 19 3935297 missense probably benign 0.19
R6556:Unc93b1 UTSW 19 3944105 missense probably benign
R6962:Unc93b1 UTSW 19 3936303 missense possibly damaging 0.57
R7143:Unc93b1 UTSW 19 3935204 missense unknown
R7748:Unc93b1 UTSW 19 3935250 missense unknown
R7866:Unc93b1 UTSW 19 3935243 missense not run
R8198:Unc93b1 UTSW 19 3941910 missense possibly damaging 0.51
R9212:Unc93b1 UTSW 19 3943557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTTTCAGGGCTGCATGC -3'
(R):5'- TCAGTCCTGATTCTTAGGCTGC -3'

Sequencing Primer
(F):5'- GTGCCCCGTTCACAAACTG -3'
(R):5'- GCTGCTAGCCTGAAACTCC -3'
Posted On 2016-06-06