Incidental Mutation 'R5057:Usp34'
ID 390956
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 042647-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R5057 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 23408086 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129521
Predicted Effect probably benign
Transcript: ENSMUST00000130131
SMART Domains Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Pfam:UCH 171 514 1.1e-48 PFAM
Pfam:UCH_1 172 470 1.6e-25 PFAM
low complexity region 763 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137823
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148927
Predicted Effect probably benign
Transcript: ENSMUST00000180046
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 97% (118/122)
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,057,581 (GRCm39) H739Q probably benign Het
Acad12 T A 5: 121,748,152 (GRCm39) T89S probably benign Het
Adgb A G 10: 10,233,722 (GRCm39) C1252R probably benign Het
Ankef1 A G 2: 136,392,280 (GRCm39) probably null Het
Ankfy1 T C 11: 72,650,745 (GRCm39) L976P probably damaging Het
Ankib1 T A 5: 3,784,011 (GRCm39) I322F possibly damaging Het
Ankrd61 T A 5: 143,831,613 (GRCm39) T64S probably benign Het
Anxa6 T G 11: 54,892,062 (GRCm39) E298A possibly damaging Het
Apc2 A G 10: 80,144,903 (GRCm39) S605G probably damaging Het
Arih1 T C 9: 59,393,515 (GRCm39) N39S unknown Het
Bicc1 A G 10: 70,783,713 (GRCm39) S393P possibly damaging Het
Bptf A T 11: 106,973,354 (GRCm39) F693L probably damaging Het
Cacng4 A G 11: 107,685,197 (GRCm39) Y32H probably damaging Het
Ccdc50 T A 16: 27,257,092 (GRCm39) D252E probably benign Het
Ccdc92b C A 11: 74,528,976 (GRCm39) T160K probably damaging Het
Cd163 C T 6: 124,302,247 (GRCm39) T937I probably damaging Het
Cdh22 C A 2: 164,958,063 (GRCm39) V635F probably damaging Het
Cenpe G T 3: 134,926,074 (GRCm39) A243S probably benign Het
Cep295 A T 9: 15,233,979 (GRCm39) H2272Q probably benign Het
Cgnl1 A T 9: 71,632,076 (GRCm39) V425D probably damaging Het
Clec4b2 A T 6: 123,177,915 (GRCm39) S77C probably null Het
Cntnap5a C T 1: 115,612,943 (GRCm39) T26I probably benign Het
Col6a3 T C 1: 90,743,852 (GRCm39) K165R possibly damaging Het
Copb1 A T 7: 113,825,997 (GRCm39) N662K probably benign Het
Crybg1 T A 10: 43,865,104 (GRCm39) R1458* probably null Het
Cspp1 T A 1: 10,145,186 (GRCm39) probably benign Het
Dhtkd1 A G 2: 5,924,324 (GRCm39) C430R probably damaging Het
Dlg5 T C 14: 24,186,690 (GRCm39) E1847G probably damaging Het
Dync2i1 A T 12: 116,177,033 (GRCm39) N856K probably benign Het
Eif1ad16 A T 12: 87,985,481 (GRCm39) S21T unknown Het
Ephb3 A G 16: 21,039,197 (GRCm39) D351G probably damaging Het
Exd2 T A 12: 80,543,564 (GRCm39) N582K probably damaging Het
Fam161a T A 11: 22,970,397 (GRCm39) C192S probably damaging Het
Fbn1 A G 2: 125,308,615 (GRCm39) V149A probably benign Het
Fbxw16 A G 9: 109,270,232 (GRCm39) S170P probably damaging Het
Fndc1 T A 17: 7,990,802 (GRCm39) R965* probably null Het
Frem2 T C 3: 53,442,617 (GRCm39) D2640G probably benign Het
Gfm1 T C 3: 67,380,877 (GRCm39) V664A probably damaging Het
Gm10803 A C 2: 93,394,517 (GRCm39) L96F probably damaging Het
Gm14569 T C X: 35,694,470 (GRCm39) D1413G probably benign Het
Gm44501 A G 17: 40,889,563 (GRCm39) T26A probably benign Het
Gpc4 G A X: 51,163,440 (GRCm39) R148C probably damaging Het
Gpsm1 G A 2: 26,215,369 (GRCm39) R277Q probably damaging Het
Inmt T A 6: 55,151,883 (GRCm39) H29L probably benign Het
Insrr T A 3: 87,722,572 (GRCm39) C1265S probably benign Het
Kctd12 A G 14: 103,219,045 (GRCm39) F278L possibly damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lag3 T A 6: 124,882,318 (GRCm39) I393F possibly damaging Het
Lama2 C T 10: 27,040,982 (GRCm39) C1447Y probably damaging Het
Lama3 G A 18: 12,665,005 (GRCm39) G2275S probably null Het
Lrrc17 A T 5: 21,780,307 (GRCm39) H427L probably benign Het
Med13l T A 5: 118,856,558 (GRCm39) S164T probably damaging Het
Milr1 A G 11: 106,657,791 (GRCm39) D131G possibly damaging Het
Myo5c A T 9: 75,208,155 (GRCm39) T1630S probably damaging Het
Nbeal2 A T 9: 110,460,073 (GRCm39) N1848K probably damaging Het
Ncor2 A T 5: 125,125,130 (GRCm39) V307E possibly damaging Het
Ndufs3 C A 2: 90,729,004 (GRCm39) A161S probably benign Het
Neo1 T C 9: 58,897,554 (GRCm39) D134G probably damaging Het
Nexmif A T X: 103,130,956 (GRCm39) N320K probably damaging Het
Nipal3 T A 4: 135,194,167 (GRCm39) I289F probably damaging Het
Nrg4 A G 9: 55,189,880 (GRCm39) probably benign Het
Nrxn3 A T 12: 89,221,804 (GRCm39) I528F probably damaging Het
Or11h23 A C 14: 50,948,669 (GRCm39) N294T probably damaging Het
Or3a10 T A 11: 73,935,881 (GRCm39) D73V probably damaging Het
Pate2 T C 9: 35,597,407 (GRCm39) probably benign Het
Pcnx2 T C 8: 126,581,930 (GRCm39) I935M possibly damaging Het
Pik3c2a G T 7: 115,975,518 (GRCm39) T683K possibly damaging Het
Pip5k1c G A 10: 81,146,723 (GRCm39) probably null Het
Pkd1l2 G A 8: 117,781,747 (GRCm39) T766I probably benign Het
Polr3c C A 3: 96,619,373 (GRCm39) L508F probably damaging Het
Por A G 5: 135,759,756 (GRCm39) D189G probably damaging Het
Potefam1 A T 2: 111,055,766 (GRCm39) F207I probably benign Het
Prim2 A T 1: 33,669,441 (GRCm39) L178* probably null Het
Prima1 C A 12: 103,168,864 (GRCm39) probably null Het
Ptpn21 G A 12: 98,645,666 (GRCm39) R1091C probably damaging Het
Ptpn23 G A 9: 110,217,624 (GRCm39) T744I probably benign Het
Rad21 A T 15: 51,830,102 (GRCm39) I503K probably benign Het
Rbm12 A T 2: 155,938,806 (GRCm39) C489S probably benign Het
Rpl10a A T 17: 28,549,607 (GRCm39) H140L probably benign Het
Rpl7-ps8 A T 15: 59,083,004 (GRCm39) noncoding transcript Het
Rtbdn T C 8: 85,681,638 (GRCm39) F143S probably damaging Het
Scamp3 T A 3: 89,089,600 (GRCm39) probably benign Het
Setd5 A G 6: 113,114,922 (GRCm39) S848G probably damaging Het
Sez6 T C 11: 77,863,979 (GRCm39) V487A probably damaging Het
Shc2 G A 10: 79,459,706 (GRCm39) P413S probably benign Het
Sipa1l3 T C 7: 29,070,618 (GRCm39) N966S probably damaging Het
Slc39a8 A G 3: 135,554,790 (GRCm39) E78G probably benign Het
Slc8a3 A G 12: 81,246,332 (GRCm39) V900A probably damaging Het
Slitrk3 T C 3: 72,957,981 (GRCm39) T264A probably benign Het
Spire2 G A 8: 124,084,940 (GRCm39) R260H probably damaging Het
Stk39 T A 2: 68,051,292 (GRCm39) I518F probably damaging Het
Tardbp T A 4: 148,703,813 (GRCm39) probably null Het
Tep1 A G 14: 51,066,456 (GRCm39) Y2335H probably benign Het
Tesl1 G A X: 23,773,480 (GRCm39) G327E probably damaging Het
Tll2 A G 19: 41,105,705 (GRCm39) V358A probably benign Het
Tmem268 C G 4: 63,486,777 (GRCm39) S100C probably damaging Het
Tnfsf9 A G 17: 57,412,444 (GRCm39) T5A probably benign Het
Trappc10 G T 10: 78,052,994 (GRCm39) F260L possibly damaging Het
Trim5 A G 7: 103,914,630 (GRCm39) Y480H probably damaging Het
Trmt112 T C 19: 6,888,121 (GRCm39) V91A probably benign Het
Ttn T A 2: 76,577,379 (GRCm39) K22759* probably null Het
Ttn C A 2: 76,748,988 (GRCm39) L4020F probably benign Het
Ubash3b A G 9: 40,948,755 (GRCm39) C187R possibly damaging Het
Ube3b T C 5: 114,544,318 (GRCm39) F572L probably benign Het
Ubr5 A G 15: 38,004,353 (GRCm39) V1332A probably damaging Het
Ubtd2 C A 11: 32,466,320 (GRCm39) R180S probably damaging Het
Ubtf A G 11: 102,197,913 (GRCm39) S673P probably damaging Het
Ubtfl1 A T 9: 18,320,487 (GRCm39) D5V possibly damaging Het
Usp17la G A 7: 104,510,330 (GRCm39) V312I possibly damaging Het
Usp17ld G T 7: 102,899,655 (GRCm39) H426N probably benign Het
Vmn1r199 A T 13: 22,567,575 (GRCm39) T290S possibly damaging Het
Vmn1r33 T C 6: 66,589,089 (GRCm39) N155S probably benign Het
Vmn2r28 T A 7: 5,489,463 (GRCm39) I459L probably benign Het
Vmn2r6 T A 3: 64,445,207 (GRCm39) K839N probably damaging Het
Vmn2r65 A G 7: 84,589,819 (GRCm39) I699T probably damaging Het
Vps16 A G 2: 130,281,372 (GRCm39) S235G probably benign Het
Vwde T C 6: 13,192,641 (GRCm39) I421V possibly damaging Het
Xiap T C X: 41,183,342 (GRCm39) F23L probably benign Het
Xkr7 A G 2: 152,896,300 (GRCm39) T385A probably benign Het
Znfx1 T C 2: 166,881,746 (GRCm39) Y217C probably damaging Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTTCTCAAACGAACAACTTGTG -3'
(R):5'- ACATGCTGTAAACACTGAAGTATGG -3'

Sequencing Primer
(F):5'- ACTTGTGTTTTTAACAGGGATTTCC -3'
(R):5'- AGTATGGTATAGAAGTAGCACTCTG -3'
Posted On 2016-06-06