Incidental Mutation 'R0437:Tmc6'
ID 39098
Institutional Source Beutler Lab
Gene Symbol Tmc6
Ensembl Gene ENSMUSG00000025572
Gene Name transmembrane channel-like gene family 6
Synonyms EVER1, D11Ertd204e
MMRRC Submission 038638-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0437 (G1)
Quality Score 188
Status Validated
Chromosome 11
Chromosomal Location 117656811-117673019 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 117669087 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 89 (T89I)
Ref Sequence ENSEMBL: ENSMUSP00000123264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026659] [ENSMUST00000050874] [ENSMUST00000103025] [ENSMUST00000106334] [ENSMUST00000117781] [ENSMUST00000119455] [ENSMUST00000143406] [ENSMUST00000131606] [ENSMUST00000136729] [ENSMUST00000127227] [ENSMUST00000152304] [ENSMUST00000127080]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000026659
AA Change: T137I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026659
Gene: ENSMUSG00000025572
AA Change: T137I

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
transmembrane domain 338 360 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
Pfam:TMC 539 645 1.5e-40 PFAM
transmembrane domain 650 672 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050874
SMART Domains Protein: ENSMUSP00000051878
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 3.1e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103025
AA Change: T137I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099314
Gene: ENSMUSG00000025572
AA Change: T137I

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106334
SMART Domains Protein: ENSMUSP00000101941
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 6e-41 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117781
SMART Domains Protein: ENSMUSP00000113570
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 1.2e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119455
SMART Domains Protein: ENSMUSP00000113628
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 2.5e-42 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143406
AA Change: T137I

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117566
Gene: ENSMUSG00000025572
AA Change: T137I

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131606
AA Change: T89I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123264
Gene: ENSMUSG00000025572
AA Change: T89I

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136729
SMART Domains Protein: ENSMUSP00000118068
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127227
Predicted Effect probably benign
Transcript: ENSMUST00000152304
Predicted Effect probably benign
Transcript: ENSMUST00000127080
SMART Domains Protein: ENSMUSP00000115270
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 10 transmembrane domains and 2 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G A 13: 119,606,631 (GRCm39) R291K probably benign Het
Abca2 T C 2: 25,332,857 (GRCm39) S1519P probably damaging Het
Abcb11 G A 2: 69,087,639 (GRCm39) A1042V probably damaging Het
Abcc10 A T 17: 46,623,845 (GRCm39) probably null Het
Abcc10 G T 17: 46,623,846 (GRCm39) probably benign Het
Alkbh3 A C 2: 93,811,914 (GRCm39) L240V probably damaging Het
Apol10b T C 15: 77,469,608 (GRCm39) S190G probably benign Het
Atp1a3 C A 7: 24,698,392 (GRCm39) C135F probably benign Het
Atp4a C G 7: 30,419,526 (GRCm39) R659G probably benign Het
Bicra A G 7: 15,722,687 (GRCm39) S277P possibly damaging Het
Bltp1 A T 3: 37,043,953 (GRCm39) H2820L possibly damaging Het
Bmp8a T C 4: 123,210,690 (GRCm39) E275G probably benign Het
Ccdc102a T C 8: 95,640,054 (GRCm39) E80G probably damaging Het
Cdh23 T C 10: 60,246,576 (GRCm39) D954G probably damaging Het
Chrm4 A G 2: 91,758,788 (GRCm39) T399A possibly damaging Het
Clcn3 A G 8: 61,387,571 (GRCm39) V199A possibly damaging Het
Crlf1 T C 8: 70,952,164 (GRCm39) probably null Het
Crx G T 7: 15,605,071 (GRCm39) S57* probably null Het
Cstpp1 A G 2: 91,252,298 (GRCm39) L21P probably damaging Het
Cyp4f16 A G 17: 32,756,072 (GRCm39) I34V possibly damaging Het
Daxx T C 17: 34,132,598 (GRCm39) V576A probably benign Het
Ddx17 C T 15: 79,421,672 (GRCm39) R351H probably damaging Het
Dhx38 T C 8: 110,285,261 (GRCm39) probably benign Het
Dnd1 T C 18: 36,897,552 (GRCm39) probably benign Het
Dync1i2 A T 2: 71,058,169 (GRCm39) probably null Het
E2f6 T C 12: 16,866,446 (GRCm39) S52P probably benign Het
Epb41l4a A G 18: 34,013,326 (GRCm39) F116S probably damaging Het
Ext1 T C 15: 52,969,502 (GRCm39) N362S probably damaging Het
Fam227a C A 15: 79,528,189 (GRCm39) K79N possibly damaging Het
Fam228a T A 12: 4,782,759 (GRCm39) L111F probably damaging Het
Fat2 T C 11: 55,173,625 (GRCm39) T2363A probably benign Het
Fat3 A T 9: 15,908,228 (GRCm39) N2591K probably damaging Het
Frem2 A G 3: 53,560,436 (GRCm39) M1357T possibly damaging Het
Frmd4b A T 6: 97,400,424 (GRCm39) V29D probably damaging Het
G930045G22Rik A G 6: 50,823,918 (GRCm39) noncoding transcript Het
Galnt3 A G 2: 65,937,573 (GRCm39) S46P possibly damaging Het
Gmeb2 A G 2: 180,895,766 (GRCm39) V468A possibly damaging Het
Herc2 C T 7: 55,869,563 (GRCm39) R4271* probably null Het
Il5 C A 11: 53,614,733 (GRCm39) probably benign Het
Ints9 G A 14: 65,223,818 (GRCm39) probably benign Het
Itga10 T C 3: 96,556,453 (GRCm39) F196S probably damaging Het
Itgb3bp T C 4: 99,670,126 (GRCm39) T138A probably damaging Het
Kcnd1 G A X: 7,690,922 (GRCm39) V281M probably benign Het
Lcp2 T C 11: 34,037,229 (GRCm39) L391P probably benign Het
Lrrc66 T C 5: 73,765,030 (GRCm39) Y671C probably benign Het
Mettl23 T C 11: 116,740,120 (GRCm39) V197A possibly damaging Het
Mmp15 C A 8: 96,097,400 (GRCm39) D456E probably benign Het
Mospd4 T C 18: 46,598,848 (GRCm39) noncoding transcript Het
Mov10l1 C A 15: 88,889,515 (GRCm39) H484N probably damaging Het
Mphosph9 T C 5: 124,453,631 (GRCm39) Q197R probably benign Het
Ms4a1 T A 19: 11,233,933 (GRCm39) probably null Het
Mybbp1a T C 11: 72,339,674 (GRCm39) V919A possibly damaging Het
Mycbpap A T 11: 94,404,338 (GRCm39) probably benign Het
Naip6 G A 13: 100,433,432 (GRCm39) S1135F possibly damaging Het
Ndufc2 T A 7: 97,049,544 (GRCm39) M50K probably benign Het
Npr2 T C 4: 43,648,082 (GRCm39) V842A probably damaging Het
Ntsr2 G T 12: 16,703,696 (GRCm39) G66W probably damaging Het
Obscn T C 11: 58,885,914 (GRCm39) probably benign Het
Optn C T 2: 5,028,926 (GRCm39) G526R probably damaging Het
Or4c11 T A 2: 88,695,229 (GRCm39) N93K probably benign Het
Or4c114 T A 2: 88,904,956 (GRCm39) I160F probably benign Het
Or6c33 T C 10: 129,853,965 (GRCm39) V245A probably damaging Het
Or6k14 G A 1: 173,927,965 (GRCm39) G314R probably benign Het
Otud4 T A 8: 80,396,626 (GRCm39) H628Q probably benign Het
Padi6 T C 4: 140,456,240 (GRCm39) T585A probably benign Het
Pex16 G T 2: 92,205,937 (GRCm39) R10L probably damaging Het
Pitpnm2 A G 5: 124,269,152 (GRCm39) probably benign Het
Pom121l2 A G 13: 22,167,375 (GRCm39) T549A possibly damaging Het
Prdm15 A T 16: 97,613,759 (GRCm39) M470K probably benign Het
Prkag2 T A 5: 25,233,503 (GRCm39) D49V possibly damaging Het
Prl3c1 A G 13: 27,383,447 (GRCm39) M38V probably benign Het
Prpf18 T A 2: 4,648,572 (GRCm39) I85F possibly damaging Het
Psg27 A G 7: 18,294,636 (GRCm39) probably benign Het
Relt A G 7: 100,497,991 (GRCm39) probably benign Het
Rskr T C 11: 78,182,362 (GRCm39) L57P probably benign Het
Serpina3b A T 12: 104,096,929 (GRCm39) N70I probably damaging Het
Slc19a3 T C 1: 83,000,286 (GRCm39) S244G probably benign Het
Slc39a5 T C 10: 128,235,716 (GRCm39) T81A possibly damaging Het
Slc7a2 G A 8: 41,357,563 (GRCm39) G277D probably damaging Het
Slc9c1 C T 16: 45,420,250 (GRCm39) probably benign Het
Slx1b A G 7: 126,291,753 (GRCm39) F104L probably benign Het
Smg6 G A 11: 74,820,527 (GRCm39) S266N probably damaging Het
Spata9 T C 13: 76,146,614 (GRCm39) V162A possibly damaging Het
Szrd1 T C 4: 140,846,055 (GRCm39) I47V probably benign Het
Tha1 G T 11: 117,759,401 (GRCm39) L363M probably benign Het
Tmem132d C T 5: 127,866,849 (GRCm39) G684R probably damaging Het
Trim55 G A 3: 19,725,142 (GRCm39) G220S probably benign Het
Ttn A G 2: 76,600,874 (GRCm39) L18836P probably damaging Het
Ubn1 G T 16: 4,890,048 (GRCm39) probably benign Het
Ush2a T G 1: 188,643,228 (GRCm39) W4197G probably benign Het
Vmn1r189 A T 13: 22,286,231 (GRCm39) V202E probably damaging Het
Vmn1r209 T C 13: 22,990,526 (GRCm39) I55V probably benign Het
Vmn2r86 A T 10: 130,282,412 (GRCm39) C735S probably damaging Het
Vwf A T 6: 125,543,281 (GRCm39) D174V probably damaging Het
Zfp438 T C 18: 5,214,910 (GRCm39) N16S probably damaging Het
Zfp444 C T 7: 6,192,408 (GRCm39) T142I probably benign Het
Zfp804a A G 2: 81,884,135 (GRCm39) M1V probably null Het
Zfp936 T G 7: 42,838,734 (GRCm39) I67S probably benign Het
Zfp948 A T 17: 21,807,260 (GRCm39) N151Y unknown Het
Other mutations in Tmc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Tmc6 APN 11 117,669,872 (GRCm39) missense probably damaging 0.99
IGL02637:Tmc6 APN 11 117,658,416 (GRCm39) missense possibly damaging 0.94
PIT4520001:Tmc6 UTSW 11 117,663,556 (GRCm39) missense possibly damaging 0.55
R0140:Tmc6 UTSW 11 117,657,077 (GRCm39) unclassified probably benign
R0149:Tmc6 UTSW 11 117,660,274 (GRCm39) missense probably damaging 1.00
R1566:Tmc6 UTSW 11 117,660,262 (GRCm39) missense probably damaging 0.99
R2011:Tmc6 UTSW 11 117,660,232 (GRCm39) missense probably damaging 1.00
R2012:Tmc6 UTSW 11 117,660,232 (GRCm39) missense probably damaging 1.00
R2169:Tmc6 UTSW 11 117,659,932 (GRCm39) missense probably damaging 1.00
R2568:Tmc6 UTSW 11 117,663,646 (GRCm39) missense probably benign 0.08
R3853:Tmc6 UTSW 11 117,663,884 (GRCm39) nonsense probably null
R4049:Tmc6 UTSW 11 117,669,087 (GRCm39) missense possibly damaging 0.88
R4655:Tmc6 UTSW 11 117,663,868 (GRCm39) missense possibly damaging 0.62
R4708:Tmc6 UTSW 11 117,659,774 (GRCm39) missense probably benign 0.00
R5001:Tmc6 UTSW 11 117,661,610 (GRCm39) missense probably benign 0.28
R5115:Tmc6 UTSW 11 117,666,014 (GRCm39) missense probably damaging 0.98
R5551:Tmc6 UTSW 11 117,660,271 (GRCm39) missense probably damaging 1.00
R5667:Tmc6 UTSW 11 117,666,441 (GRCm39) missense possibly damaging 0.87
R5671:Tmc6 UTSW 11 117,666,441 (GRCm39) missense possibly damaging 0.87
R5763:Tmc6 UTSW 11 117,660,259 (GRCm39) missense possibly damaging 0.90
R6137:Tmc6 UTSW 11 117,667,154 (GRCm39) missense probably damaging 1.00
R6354:Tmc6 UTSW 11 117,665,062 (GRCm39) missense probably benign 0.32
R6418:Tmc6 UTSW 11 117,661,326 (GRCm39) missense probably damaging 0.99
R6868:Tmc6 UTSW 11 117,665,143 (GRCm39) missense probably benign 0.01
R7006:Tmc6 UTSW 11 117,665,083 (GRCm39) missense probably damaging 0.96
R7208:Tmc6 UTSW 11 117,667,151 (GRCm39) missense probably benign 0.41
R7210:Tmc6 UTSW 11 117,666,670 (GRCm39) missense possibly damaging 0.59
R7633:Tmc6 UTSW 11 117,660,046 (GRCm39) missense probably benign
R8802:Tmc6 UTSW 11 117,665,901 (GRCm39) missense possibly damaging 0.81
R8959:Tmc6 UTSW 11 117,661,293 (GRCm39) critical splice donor site probably null
R9002:Tmc6 UTSW 11 117,661,308 (GRCm39) missense probably damaging 1.00
R9621:Tmc6 UTSW 11 117,669,995 (GRCm39) missense probably benign 0.00
Z1177:Tmc6 UTSW 11 117,669,573 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGTCTCACCCAGCAAGAAGTAAGC -3'
(R):5'- ATACCCTGCCACCGGATTTCCAAG -3'

Sequencing Primer
(F):5'- GAGCTATTACTGGAGCTACTGACC -3'
(R):5'- ATTTCCAAGGTCGCAGCC -3'
Posted On 2013-05-23