Incidental Mutation 'R5057:Lama3'
ID390989
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Namelaminin, alpha 3
Synonyms[a]3B, nicein, 150kDa
MMRRC Submission 042647-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5057 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location12333819-12583013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12531948 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 2275 (G2275S)
Ref Sequence ENSEMBL: ENSMUSP00000089703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]
Predicted Effect probably null
Transcript: ENSMUST00000092070
AA Change: G2275S

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: G2275S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188815
AA Change: G669S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421
AA Change: G669S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_Lam 78 122 2.66e-10 SMART
EGF_Lam 125 175 7.81e-8 SMART
Pfam:Laminin_I 230 496 1e-90 PFAM
low complexity region 579 594 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
LamG 800 960 1.67e-2 SMART
LamG 1008 1136 1.72e-17 SMART
LamG 1179 1294 3.96e-17 SMART
LamG 1399 1527 1.12e-34 SMART
LamG 1569 1702 3.41e-30 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,225,421 F207I probably benign Het
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Acad12 T A 5: 121,610,089 T89S probably benign Het
Adgb A G 10: 10,357,978 C1252R probably benign Het
Ankef1 A G 2: 136,550,360 probably null Het
Ankfy1 T C 11: 72,759,919 L976P probably damaging Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
Ankrd61 T A 5: 143,894,795 T64S probably benign Het
Anxa6 T G 11: 55,001,236 E298A possibly damaging Het
Apc2 A G 10: 80,309,069 S605G probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Bptf A T 11: 107,082,528 F693L probably damaging Het
Cacng4 A G 11: 107,794,371 Y32H probably damaging Het
Ccdc50 T A 16: 27,438,342 D252E probably benign Het
Ccdc92b C A 11: 74,638,150 T160K probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh22 C A 2: 165,116,143 V635F probably damaging Het
Cenpe G T 3: 135,220,313 A243S probably benign Het
Cep295 A T 9: 15,322,683 H2272Q probably benign Het
Cgnl1 A T 9: 71,724,794 V425D probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Cntnap5a C T 1: 115,685,213 T26I probably benign Het
Col6a3 T C 1: 90,816,130 K165R possibly damaging Het
Copb1 A T 7: 114,226,762 N662K probably benign Het
Crybg1 T A 10: 43,989,108 R1458* probably null Het
Cspp1 T A 1: 10,074,961 probably benign Het
Dhtkd1 A G 2: 5,919,513 C430R probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Ephb3 A G 16: 21,220,447 D351G probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fam161a T A 11: 23,020,397 C192S probably damaging Het
Fbn1 A G 2: 125,466,695 V149A probably benign Het
Fbxw16 A G 9: 109,441,164 S170P probably damaging Het
Fndc1 T A 17: 7,771,970 R965* probably null Het
Frem2 T C 3: 53,535,196 D2640G probably benign Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm44501 A G 17: 40,578,672 T26A probably benign Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5045 A T 15: 59,211,155 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpsm1 G A 2: 26,325,357 R277Q probably damaging Het
Inmt T A 6: 55,174,898 H29L probably benign Het
Insrr T A 3: 87,815,265 C1265S probably benign Het
Kctd12 A G 14: 102,981,609 F278L possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lag3 T A 6: 124,905,355 I393F possibly damaging Het
Lama2 C T 10: 27,164,986 C1447Y probably damaging Het
Lrrc17 A T 5: 21,575,309 H427L probably benign Het
Med13l T A 5: 118,718,493 S164T probably damaging Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Myo5c A T 9: 75,300,873 T1630S probably damaging Het
Nbeal2 A T 9: 110,631,005 N1848K probably damaging Het
Ncor2 A T 5: 125,048,066 V307E possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Nipal3 T A 4: 135,466,856 I289F probably damaging Het
Nrg4 A G 9: 55,282,596 probably benign Het
Nrxn3 A T 12: 89,255,034 I528F probably damaging Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr748 A C 14: 50,711,212 N294T probably damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcnx2 T C 8: 125,855,191 I935M possibly damaging Het
Pik3c2a G T 7: 116,376,283 T683K possibly damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkd1l2 G A 8: 117,055,008 T766I probably benign Het
Polr3c C A 3: 96,712,057 L508F probably damaging Het
Por A G 5: 135,730,902 D189G probably damaging Het
Prim2 A T 1: 33,630,360 L178* probably null Het
Prima1 C A 12: 103,202,605 probably null Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rbm12 A T 2: 156,096,886 C489S probably benign Het
Rpl10a A T 17: 28,330,633 H140L probably benign Het
Rtbdn T C 8: 84,955,009 F143S probably damaging Het
Scamp3 T A 3: 89,182,293 probably benign Het
Setd5 A G 6: 113,137,961 S848G probably damaging Het
Sez6 T C 11: 77,973,153 V487A probably damaging Het
Shc2 G A 10: 79,623,872 P413S probably benign Het
Sipa1l3 T C 7: 29,371,193 N966S probably damaging Het
Slc39a8 A G 3: 135,849,029 E78G probably benign Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Spire2 G A 8: 123,358,201 R260H probably damaging Het
Stk39 T A 2: 68,220,948 I518F probably damaging Het
Tardbp T A 4: 148,619,356 probably null Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Tll2 A G 19: 41,117,266 V358A probably benign Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tnfsf9 A G 17: 57,105,444 T5A probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim5 A G 7: 104,265,423 Y480H probably damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttn T A 2: 76,747,035 K22759* probably null Het
Ttn C A 2: 76,918,644 L4020F probably benign Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Ube3b T C 5: 114,406,257 F572L probably benign Het
Ubr5 A G 15: 38,004,109 V1332A probably damaging Het
Ubtd2 C A 11: 32,516,320 R180S probably damaging Het
Ubtf A G 11: 102,307,087 S673P probably damaging Het
Ubtfl1 A T 9: 18,409,191 D5V possibly damaging Het
Usp17la G A 7: 104,861,123 V312I possibly damaging Het
Usp17ld G T 7: 103,250,448 H426N probably benign Het
Usp34 A G 11: 23,458,086 probably benign Het
Vmn1r199 A T 13: 22,383,405 T290S possibly damaging Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vmn2r6 T A 3: 64,537,786 K839N probably damaging Het
Vmn2r65 A G 7: 84,940,611 I699T probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Wdr60 A T 12: 116,213,413 N856K probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0325:Lama3 UTSW 18 12482126 missense probably damaging 1.00
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 unclassified probably null
R0453:Lama3 UTSW 18 12465478 missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1757:Lama3 UTSW 18 12465499 missense probably benign 0.10
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2086:Lama3 UTSW 18 12524830 missense probably benign 0.39
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4702:Lama3 UTSW 18 12578029 nonsense probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R7019:Lama3 UTSW 18 12528418 missense probably damaging 0.97
R7026:Lama3 UTSW 18 12516548 missense probably damaging 0.98
R7088:Lama3 UTSW 18 12582545 missense possibly damaging 0.90
R7100:Lama3 UTSW 18 12582644 missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12552813 missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12531879 missense probably benign 0.00
R7121:Lama3 UTSW 18 12462782 missense probably benign 0.06
R7133:Lama3 UTSW 18 12539786 missense probably benign 0.05
R7150:Lama3 UTSW 18 12468289 missense probably damaging 1.00
R7158:Lama3 UTSW 18 12456812 missense probably benign 0.20
R7170:Lama3 UTSW 18 12404076 missense probably benign 0.26
R7216:Lama3 UTSW 18 12430000 missense probably damaging 1.00
R7223:Lama3 UTSW 18 12582608 missense possibly damaging 0.53
R7243:Lama3 UTSW 18 12419845 missense probably damaging 1.00
R7282:Lama3 UTSW 18 12439392 missense probably damaging 0.99
R7337:Lama3 UTSW 18 12507040 splice site probably null
R7442:Lama3 UTSW 18 12472181 critical splice acceptor site probably null
R7487:Lama3 UTSW 18 12419237 missense probably benign
R7604:Lama3 UTSW 18 12500493 missense possibly damaging 0.93
R7609:Lama3 UTSW 18 12531834 critical splice acceptor site probably null
R7650:Lama3 UTSW 18 12537838 missense probably benign 0.01
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGCATGAAGTAATTGCTTCTTGG -3'
(R):5'- CCCAAATCTGTCTGGATGGG -3'

Sequencing Primer
(F):5'- GAAGTAATTGCTTCTTGGTGTCTCCC -3'
(R):5'- CAAATCTGTCTGGATGGGGTTGAG -3'
Posted On2016-06-06