Incidental Mutation 'R5058:Camsap1'
ID390996
Institutional Source Beutler Lab
Gene Symbol Camsap1
Ensembl Gene ENSMUSG00000026933
Gene Namecalmodulin regulated spectrin-associated protein 1
Synonyms9530003A05Rik, PRO2405
MMRRC Submission 042648-MU
Accession Numbers

Genbank: NM_001115076; MGI: 3036242

Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R5058 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25926838-25983282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25939363 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 783 (D783G)
Ref Sequence ENSEMBL: ENSMUSP00000139028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091268] [ENSMUST00000114167] [ENSMUST00000134882] [ENSMUST00000183461]
AlphaFold A2AHC3
Predicted Effect probably benign
Transcript: ENSMUST00000091268
AA Change: D783G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000088812
Gene: ENSMUSG00000026933
AA Change: D783G

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 228 311 3.3e-35 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
Pfam:CAMSAP_CC1 859 917 3.8e-29 PFAM
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114167
AA Change: D783G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109804
Gene: ENSMUSG00000026933
AA Change: D783G

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134882
AA Change: D803G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117203
Gene: ENSMUSG00000026933
AA Change: D803G

DomainStartEndE-ValueType
Pfam:CH 185 350 1.3e-33 PFAM
Pfam:CAMSAP_CH 248 331 2.6e-34 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
coiled coil region 889 925 N/A INTRINSIC
coiled coil region 1030 1057 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134970
Predicted Effect probably benign
Transcript: ENSMUST00000143977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148146
Predicted Effect probably benign
Transcript: ENSMUST00000183461
AA Change: D783G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139028
Gene: ENSMUSG00000026933
AA Change: D783G

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Meta Mutation Damage Score 0.0906 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Camsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Camsap1 APN 2 25933623 missense possibly damaging 0.95
IGL01555:Camsap1 APN 2 25939393 missense possibly damaging 0.81
IGL01667:Camsap1 APN 2 25945281 splice site probably benign
IGL02167:Camsap1 APN 2 25934300 missense probably damaging 1.00
IGL02191:Camsap1 APN 2 25929880 missense probably damaging 0.97
IGL02285:Camsap1 APN 2 25929802 missense probably damaging 1.00
IGL02393:Camsap1 APN 2 25938322 missense probably benign 0.10
3-1:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R0631:Camsap1 UTSW 2 25933647 missense probably damaging 0.98
R0828:Camsap1 UTSW 2 25939085 missense probably damaging 1.00
R1434:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R1687:Camsap1 UTSW 2 25939615 missense probably damaging 1.00
R2027:Camsap1 UTSW 2 25938526 missense possibly damaging 0.51
R2048:Camsap1 UTSW 2 25929743 missense probably benign 0.00
R3732:Camsap1 UTSW 2 25938344 missense probably damaging 1.00
R4437:Camsap1 UTSW 2 25938646 missense possibly damaging 0.89
R4494:Camsap1 UTSW 2 25952758 missense probably damaging 1.00
R4888:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5028:Camsap1 UTSW 2 25944556 missense probably damaging 1.00
R5105:Camsap1 UTSW 2 25940929 missense probably damaging 1.00
R5121:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5153:Camsap1 UTSW 2 25933618 missense probably damaging 1.00
R5323:Camsap1 UTSW 2 25965811 missense probably damaging 0.98
R6043:Camsap1 UTSW 2 25929925 missense probably benign 0.00
R6479:Camsap1 UTSW 2 25935862 missense possibly damaging 0.88
R6502:Camsap1 UTSW 2 25956308 missense probably damaging 1.00
R6571:Camsap1 UTSW 2 25939500 missense possibly damaging 0.89
R7046:Camsap1 UTSW 2 25945189 missense probably damaging 0.99
R7251:Camsap1 UTSW 2 25938886 missense probably damaging 0.99
R8026:Camsap1 UTSW 2 25938202 missense probably benign 0.17
R8133:Camsap1 UTSW 2 25934297 missense probably damaging 0.99
R8152:Camsap1 UTSW 2 25940241 missense probably damaging 1.00
R8158:Camsap1 UTSW 2 25944428 nonsense probably null
R8325:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R8339:Camsap1 UTSW 2 25982805 missense possibly damaging 0.74
Z1176:Camsap1 UTSW 2 25936639 missense probably damaging 1.00
Z1176:Camsap1 UTSW 2 25940881 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCATCAGGGGTGGTCTTC -3'
(R):5'- TTCTTTCTCCATGTAGGCAGG -3'

Sequencing Primer
(F):5'- CTGGGAGCTGCTGGTGC -3'
(R):5'- GTACGTTGGTTCACAAAGTCCTAGC -3'
Posted On2016-06-06