Incidental Mutation 'R5058:Cbfa2t2'
ID390999
Institutional Source Beutler Lab
Gene Symbol Cbfa2t2
Ensembl Gene ENSMUSG00000038533
Gene Namecore-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human)
SynonymsCbfa2t2h, MTGR1, C330013D05Rik
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.639) question?
Stock #R5058 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154436481-154539356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154504745 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 124 (I124N)
Ref Sequence ENSEMBL: ENSMUSP00000043087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045270] [ENSMUST00000099178] [ENSMUST00000109724] [ENSMUST00000109725]
Predicted Effect probably damaging
Transcript: ENSMUST00000045270
AA Change: I124N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043087
Gene: ENSMUSG00000038533
AA Change: I124N

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1.3e-40 PFAM
PDB:2KYG|C 420 450 3e-7 PDB
Pfam:zf-MYND 498 534 1.4e-9 PFAM
low complexity region 573 588 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099178
AA Change: I124N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096782
Gene: ENSMUSG00000038533
AA Change: I124N

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 4.4e-40 PFAM
low complexity region 402 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109724
AA Change: I76N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105346
Gene: ENSMUSG00000038533
AA Change: I76N

DomainStartEndE-ValueType
TAFH 58 148 1.06e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109725
AA Change: I124N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105347
Gene: ENSMUSG00000038533
AA Change: I124N

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1e-40 PFAM
Pfam:zf-MYND 497 533 3.3e-11 PFAM
low complexity region 572 587 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155202
AA Change: I181N
SMART Domains Protein: ENSMUSP00000116220
Gene: ENSMUSG00000038533
AA Change: I181N

DomainStartEndE-ValueType
low complexity region 91 110 N/A INTRINSIC
Pfam:TAFH 164 192 7.1e-9 PFAM
Meta Mutation Damage Score 0.6982 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In acute myeloid leukemia, especially in the M2 subtype, the t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities. The translocation produces a chimeric gene made up of the 5'-region of the RUNX1 (AML1) gene fused to the 3'-region of the CBFA2T1 (MTG8) gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. The protein encoded by this gene binds to the AML1-MTG8 complex and may be important in promoting leukemogenesis. Several transcript variants are thought to exist for this gene, but the full-length natures of only three have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are smaller and show reduced numbers of intestinal goblet, Paneth and enteroendocrine cells, small intestine inflammation, and strain dependent postnatal lethality. Homozygotes for a different null allele are infertile due to defects in primordial germ cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Cbfa2t2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cbfa2t2 APN 2 154528875 missense probably damaging 1.00
IGL01913:Cbfa2t2 APN 2 154517773 missense probably damaging 1.00
IGL02090:Cbfa2t2 APN 2 154531416 splice site probably benign
IGL02850:Cbfa2t2 APN 2 154535170 missense probably damaging 0.97
R0302:Cbfa2t2 UTSW 2 154534876 splice site probably benign
R0356:Cbfa2t2 UTSW 2 154531349 missense probably benign 0.03
R1218:Cbfa2t2 UTSW 2 154523919 missense probably benign 0.43
R1571:Cbfa2t2 UTSW 2 154500427 missense probably damaging 1.00
R1998:Cbfa2t2 UTSW 2 154504789 missense probably damaging 1.00
R2016:Cbfa2t2 UTSW 2 154517807 missense probably damaging 1.00
R2017:Cbfa2t2 UTSW 2 154517807 missense probably damaging 1.00
R2056:Cbfa2t2 UTSW 2 154535157 missense probably damaging 1.00
R3617:Cbfa2t2 UTSW 2 154436984 intron probably benign
R4299:Cbfa2t2 UTSW 2 154523928 missense probably damaging 1.00
R4746:Cbfa2t2 UTSW 2 154523925 missense possibly damaging 0.94
R4969:Cbfa2t2 UTSW 2 154523980 missense probably damaging 1.00
R5109:Cbfa2t2 UTSW 2 154531373 missense probably damaging 1.00
R5381:Cbfa2t2 UTSW 2 154523929 missense probably damaging 1.00
R5573:Cbfa2t2 UTSW 2 154436862 intron probably benign
R5808:Cbfa2t2 UTSW 2 154517826 splice site probably null
R5826:Cbfa2t2 UTSW 2 154500455 missense possibly damaging 0.90
R5977:Cbfa2t2 UTSW 2 154517777 missense probably damaging 1.00
R6052:Cbfa2t2 UTSW 2 154510581 missense probably damaging 1.00
R6842:Cbfa2t2 UTSW 2 154524045 missense probably benign 0.02
R6923:Cbfa2t2 UTSW 2 154534983 missense probably damaging 1.00
R7269:Cbfa2t2 UTSW 2 154515975 missense probably benign 0.37
R7318:Cbfa2t2 UTSW 2 154500454 missense probably benign 0.01
R7622:Cbfa2t2 UTSW 2 154500445 missense possibly damaging 0.90
R8030:Cbfa2t2 UTSW 2 154515896 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTTCTGCACTCACTGACTC -3'
(R):5'- TGACAAACAAATGCTGCTACG -3'

Sequencing Primer
(F):5'- TTAGTAAGCAATGGCATCAACC -3'
(R):5'- TGACAAACAAATGCTGCTACGAAATC -3'
Posted On2016-06-06