Incidental Mutation 'R5058:Epb41'
ID 391005
Institutional Source Beutler Lab
Gene Symbol Epb41
Ensembl Gene ENSMUSG00000028906
Gene Name erythrocyte membrane protein band 4.1
Synonyms 4.1R, Epb4.1, Elp1, Elp-1, D4Ertd442e
MMRRC Submission 042648-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5058 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 131650724-131802632 bp(-) (GRCm39)
Type of Mutation utr 5 prime
DNA Base Change (assembly) G to A at 131734746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030739] [ENSMUST00000054917] [ENSMUST00000084253] [ENSMUST00000105970] [ENSMUST00000105972] [ENSMUST00000105974] [ENSMUST00000137846] [ENSMUST00000141291] [ENSMUST00000105981] [ENSMUST00000105975]
AlphaFold P48193
Predicted Effect probably benign
Transcript: ENSMUST00000030739
SMART Domains Protein: ENSMUSP00000030739
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054917
SMART Domains Protein: ENSMUSP00000060375
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084253
SMART Domains Protein: ENSMUSP00000081274
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105970
SMART Domains Protein: ENSMUSP00000101590
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
B41 55 250 1.3e-80 SMART
FERM_C 254 344 1.01e-35 SMART
FA 347 393 8.99e-19 SMART
low complexity region 437 459 N/A INTRINSIC
Pfam:SAB 476 524 1.1e-29 PFAM
Pfam:4_1_CTD 578 636 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105972
SMART Domains Protein: ENSMUSP00000101592
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105974
SMART Domains Protein: ENSMUSP00000101594
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 367 3.77e-50 SMART
FERM_C 371 461 1.01e-35 SMART
FA 464 510 8.99e-19 SMART
Pfam:SAB 572 620 2e-28 PFAM
Pfam:4_1_CTD 652 766 3e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146021
Predicted Effect probably benign
Transcript: ENSMUST00000137846
SMART Domains Protein: ENSMUSP00000123623
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
B41 49 244 1.3e-80 SMART
FERM_C 248 338 1.01e-35 SMART
FA 341 387 8.99e-19 SMART
low complexity region 431 453 N/A INTRINSIC
Pfam:SAB 470 518 1.2e-29 PFAM
Pfam:4_1_CTD 550 664 2.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141291
SMART Domains Protein: ENSMUSP00000120236
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 647 695 1.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105981
SMART Domains Protein: ENSMUSP00000101601
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105975
SMART Domains Protein: ENSMUSP00000101595
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 232 427 1.3e-80 SMART
FERM_C 431 521 1.01e-35 SMART
FA 524 570 8.99e-19 SMART
low complexity region 619 632 N/A INTRINSIC
Pfam:SAB 672 720 3.9e-25 PFAM
Pfam:4_1_CTD 758 865 2.6e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with spectrin and actin, constitute the red cell membrane cytoskeletal network. This complex plays a critical role in erythrocyte shape and deformability. Mutations in this gene are associated with type 1 elliptocytosis (EL1). Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit moderate hemolytic anemia, erythrocytic abnormalities including aberrant morphology, reduced membrane stability, and lowered expression of spectrin and ankyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,292,625 (GRCm39) Y222C probably damaging Het
Adprs A G 4: 126,212,238 (GRCm39) S94P probably damaging Het
Atp11b A G 3: 35,863,510 (GRCm39) E202G probably benign Het
Cacna1d G T 14: 29,836,201 (GRCm39) S849* probably null Het
Camsap1 T C 2: 25,829,375 (GRCm39) D783G probably benign Het
Cbfa2t2 T A 2: 154,346,665 (GRCm39) I124N probably damaging Het
Ccdc13 A T 9: 121,646,613 (GRCm39) probably benign Het
Cfap44 G A 16: 44,240,567 (GRCm39) probably null Het
Col17a1 C A 19: 47,673,989 (GRCm39) E13* probably null Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dennd6b A G 15: 89,071,553 (GRCm39) L288P possibly damaging Het
Dhx37 A C 5: 125,499,295 (GRCm39) Y638D probably benign Het
Esp31 A T 17: 38,955,500 (GRCm39) I48L possibly damaging Het
Fat3 T C 9: 15,908,154 (GRCm39) Q2616R probably damaging Het
Fbxo33 A G 12: 59,265,919 (GRCm39) I116T probably benign Het
Flnb G T 14: 7,924,262 (GRCm38) E1792* probably null Het
Fzd2 G A 11: 102,495,633 (GRCm39) G26R probably damaging Het
Gm11677 T A 11: 111,616,264 (GRCm39) noncoding transcript Het
Gm7137 A T 10: 77,623,905 (GRCm39) probably benign Het
Hnrnpr A G 4: 136,063,648 (GRCm39) T252A possibly damaging Het
Hyal5 T C 6: 24,891,484 (GRCm39) F433L probably damaging Het
Kcnmb4 T A 10: 116,299,833 (GRCm39) probably benign Het
Meltf A G 16: 31,706,421 (GRCm39) probably null Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Muc6 T C 7: 141,230,491 (GRCm39) D1213G probably benign Het
Ncam1 A C 9: 49,709,995 (GRCm39) F12C probably benign Het
Nfxl1 A T 5: 72,713,582 (GRCm39) D120E probably benign Het
Nrg1 T C 8: 32,314,587 (GRCm39) Q142R probably damaging Het
Or10c1 A G 17: 37,522,558 (GRCm39) L62P probably damaging Het
Or1j18 T G 2: 36,625,011 (GRCm39) L226R possibly damaging Het
Or2h15 G A 17: 38,441,432 (GRCm39) S217F probably damaging Het
Or56a4 T C 7: 104,806,355 (GRCm39) N178S probably damaging Het
Or5k16 T C 16: 58,736,435 (GRCm39) T190A probably benign Het
Or8c10 C A 9: 38,279,220 (GRCm39) T116K probably damaging Het
Or8g30 C A 9: 39,229,960 (GRCm39) V317L probably benign Het
Or9s18 C A 13: 65,300,743 (GRCm39) A235D possibly damaging Het
Padi2 G T 4: 140,659,432 (GRCm39) V246L probably benign Het
Pgghg C T 7: 140,522,455 (GRCm39) T63I possibly damaging Het
Pitpnm1 A G 19: 4,162,758 (GRCm39) N1117S probably benign Het
Plch1 G T 3: 63,630,202 (GRCm39) T534K probably damaging Het
Poc1a G T 9: 106,227,012 (GRCm39) probably benign Het
Polr3c T C 3: 96,630,833 (GRCm39) I196V probably benign Het
Prph A T 15: 98,953,113 (GRCm39) probably benign Het
Ptprg C A 14: 12,037,387 (GRCm38) T189K possibly damaging Het
R3hcc1 A T 14: 69,941,463 (GRCm39) I183N probably damaging Het
Rundc1 T C 11: 101,316,363 (GRCm39) L145P probably benign Het
Slc26a3 A G 12: 31,520,964 (GRCm39) K723E possibly damaging Het
Slc38a3 T C 9: 107,536,390 (GRCm39) E2G possibly damaging Het
Slc9a5 G T 8: 106,082,490 (GRCm39) V252L probably benign Het
Smim26 C T 2: 144,437,043 (GRCm39) T64M probably benign Het
Socs4 C T 14: 47,527,589 (GRCm39) R175* probably null Het
Srebf2 T C 15: 82,066,251 (GRCm39) S600P probably damaging Het
Tas2r107 A T 6: 131,636,705 (GRCm39) S115T probably damaging Het
Tenm2 T C 11: 36,097,907 (GRCm39) D447G possibly damaging Het
Thbs2 T A 17: 14,896,591 (GRCm39) D766V probably damaging Het
Tinagl1 A G 4: 130,061,250 (GRCm39) V300A probably benign Het
Tle6 T A 10: 81,430,072 (GRCm39) N332I possibly damaging Het
Tle6 C A 10: 81,431,791 (GRCm39) W151L probably damaging Het
Tnfrsf13c C T 15: 82,108,408 (GRCm39) V36M probably damaging Het
Tns2 T C 15: 102,016,295 (GRCm39) I211T possibly damaging Het
Trp63 A G 16: 25,701,344 (GRCm39) N379D probably damaging Het
Trpc2 T C 7: 101,738,316 (GRCm39) W433R probably damaging Het
Tyw1 T A 5: 130,305,927 (GRCm39) L350Q probably benign Het
Usf3 T C 16: 44,033,070 (GRCm39) L76P probably damaging Het
Vmn2r79 T C 7: 86,651,423 (GRCm39) L274P probably damaging Het
Other mutations in Epb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Epb41 APN 4 131,702,042 (GRCm39) missense probably benign
IGL00897:Epb41 APN 4 131,727,508 (GRCm39) splice site probably null
IGL00911:Epb41 APN 4 131,717,095 (GRCm39) missense possibly damaging 0.60
IGL01390:Epb41 APN 4 131,731,048 (GRCm39) missense probably benign
IGL01459:Epb41 APN 4 131,691,439 (GRCm39) intron probably benign
IGL01816:Epb41 APN 4 131,731,006 (GRCm39) missense probably benign 0.00
IGL02192:Epb41 APN 4 131,657,028 (GRCm39) missense probably damaging 0.99
IGL02296:Epb41 APN 4 131,731,065 (GRCm39) missense probably benign 0.42
IGL03011:Epb41 APN 4 131,731,105 (GRCm39) missense probably damaging 1.00
IGL03268:Epb41 APN 4 131,655,806 (GRCm39) missense probably damaging 1.00
IGL03388:Epb41 APN 4 131,702,105 (GRCm39) missense probably damaging 1.00
R0355:Epb41 UTSW 4 131,727,572 (GRCm39) missense probably damaging 0.99
R0532:Epb41 UTSW 4 131,706,106 (GRCm39) splice site probably benign
R0550:Epb41 UTSW 4 131,702,924 (GRCm39) missense probably damaging 1.00
R0571:Epb41 UTSW 4 131,717,215 (GRCm39) missense probably damaging 1.00
R1158:Epb41 UTSW 4 131,727,502 (GRCm39) splice site probably benign
R1444:Epb41 UTSW 4 131,733,382 (GRCm39) missense probably benign
R2106:Epb41 UTSW 4 131,717,152 (GRCm39) missense probably damaging 1.00
R2269:Epb41 UTSW 4 131,691,458 (GRCm39) missense probably benign 0.09
R4014:Epb41 UTSW 4 131,709,756 (GRCm39) splice site probably benign
R4017:Epb41 UTSW 4 131,709,756 (GRCm39) splice site probably benign
R4952:Epb41 UTSW 4 131,727,581 (GRCm39) missense probably damaging 0.99
R4976:Epb41 UTSW 4 131,664,747 (GRCm39) unclassified probably benign
R5119:Epb41 UTSW 4 131,664,747 (GRCm39) unclassified probably benign
R5229:Epb41 UTSW 4 131,706,246 (GRCm39) missense probably damaging 1.00
R5571:Epb41 UTSW 4 131,664,717 (GRCm39) unclassified probably benign
R6250:Epb41 UTSW 4 131,717,184 (GRCm39) missense probably damaging 1.00
R6531:Epb41 UTSW 4 131,684,947 (GRCm39) missense probably benign 0.00
R6890:Epb41 UTSW 4 131,663,140 (GRCm39) missense probably damaging 0.98
R7265:Epb41 UTSW 4 131,695,145 (GRCm39) missense unknown
R7289:Epb41 UTSW 4 131,718,520 (GRCm39) critical splice donor site probably null
R7322:Epb41 UTSW 4 131,717,030 (GRCm39) missense probably damaging 0.99
R7823:Epb41 UTSW 4 131,701,993 (GRCm39) critical splice donor site probably null
R8296:Epb41 UTSW 4 131,664,772 (GRCm39) missense
R8317:Epb41 UTSW 4 131,684,961 (GRCm39) missense
R8401:Epb41 UTSW 4 131,702,018 (GRCm39) missense probably damaging 1.00
R8880:Epb41 UTSW 4 131,695,104 (GRCm39) missense
R9065:Epb41 UTSW 4 131,682,888 (GRCm39) missense
R9414:Epb41 UTSW 4 131,702,162 (GRCm39) missense probably damaging 1.00
R9682:Epb41 UTSW 4 131,655,820 (GRCm39) missense
X0066:Epb41 UTSW 4 131,702,051 (GRCm39) missense probably damaging 1.00
Z1177:Epb41 UTSW 4 131,733,394 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGTCTTCATGTGTTGGAGTGTCC -3'
(R):5'- GCATATCTTTCATGACTTAAGGCAC -3'

Sequencing Primer
(F):5'- CATTGGATGCTTTCAGCTTCTG -3'
(R):5'- GGCACTAATAATTTATTCAGGATGGG -3'
Posted On 2016-06-06