Incidental Mutation 'R5058:Nfxl1'
ID391011
Institutional Source Beutler Lab
Gene Symbol Nfxl1
Ensembl Gene ENSMUSG00000072889
Gene Namenuclear transcription factor, X-box binding-like 1
Synonyms1700012H24Rik, TCF9, D430033A06Rik, LOC381696
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R5058 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72513301-72559684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72556239 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 120 (D120E)
Ref Sequence ENSEMBL: ENSMUSP00000074481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074948] [ENSMUST00000087216] [ENSMUST00000135318]
Predicted Effect probably benign
Transcript: ENSMUST00000074948
AA Change: D120E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074481
Gene: ENSMUSG00000072889
AA Change: D120E

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087216
AA Change: D120E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084467
Gene: ENSMUSG00000072889
AA Change: D120E

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
ZnF_NFX 483 502 9.71e-2 SMART
ZnF_NFX 510 529 3.49e-3 SMART
ZnF_NFX 567 587 4.56e1 SMART
Pfam:zf-NF-X1 596 608 6.8e-3 PFAM
ZnF_NFX 677 710 4.23e1 SMART
ZnF_NFX 720 738 5.49e-1 SMART
ZnF_NFX 782 801 1.63e-3 SMART
coiled coil region 829 880 N/A INTRINSIC
transmembrane domain 897 914 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134452
Predicted Effect probably benign
Transcript: ENSMUST00000135318
AA Change: D120E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114355
Gene: ENSMUSG00000072889
AA Change: D120E

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198977
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Nfxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Nfxl1 APN 5 72550428 splice site probably benign
IGL01716:Nfxl1 APN 5 72540934 missense probably damaging 1.00
IGL02592:Nfxl1 APN 5 72514229 missense probably benign 0.25
IGL03083:Nfxl1 APN 5 72540662 splice site probably benign
FR4548:Nfxl1 UTSW 5 72559115 small insertion probably benign
FR4737:Nfxl1 UTSW 5 72559121 small insertion probably benign
R0478:Nfxl1 UTSW 5 72524645 critical splice donor site probably null
R0725:Nfxl1 UTSW 5 72559130 missense probably benign
R1374:Nfxl1 UTSW 5 72524145 missense probably benign 0.04
R1616:Nfxl1 UTSW 5 72529037 missense probably benign 0.01
R1752:Nfxl1 UTSW 5 72540875 missense probably damaging 1.00
R2108:Nfxl1 UTSW 5 72514332 critical splice acceptor site probably null
R3081:Nfxl1 UTSW 5 72529035 missense possibly damaging 0.92
R3693:Nfxl1 UTSW 5 72540611 missense probably damaging 0.99
R3725:Nfxl1 UTSW 5 72517062 missense probably damaging 1.00
R4660:Nfxl1 UTSW 5 72552668 missense probably damaging 1.00
R5406:Nfxl1 UTSW 5 72556198 missense possibly damaging 0.92
R5447:Nfxl1 UTSW 5 72529169 missense probably benign 0.01
R5634:Nfxl1 UTSW 5 72529490 missense probably damaging 1.00
R5831:Nfxl1 UTSW 5 72522197 missense probably benign
R5910:Nfxl1 UTSW 5 72540365 missense probably benign 0.05
R6086:Nfxl1 UTSW 5 72541019 missense probably benign 0.39
R6091:Nfxl1 UTSW 5 72514190 missense probably benign 0.00
R6212:Nfxl1 UTSW 5 72516210 critical splice donor site probably null
R6501:Nfxl1 UTSW 5 72528509 unclassified probably null
R6521:Nfxl1 UTSW 5 72540308 unclassified probably null
R7283:Nfxl1 UTSW 5 72529050 missense probably benign
R7426:Nfxl1 UTSW 5 72524174 nonsense probably null
R7480:Nfxl1 UTSW 5 72559252 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAAATGTCCTCAGCTTTACAAGATG -3'
(R):5'- TAAACTGGAATCTTACTGATCCGG -3'

Sequencing Primer
(F):5'- AAGATGACCACACTAAAAATGATCC -3'
(R):5'- AAAAAGAGGTGTCATTCTACAGC -3'
Posted On2016-06-06