Mutagenetix > Incidental Mutation

Incidental Mutation 'R5058:Vmn2r79'

391018

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r79

Ensembl Gene

ENSMUSG00000090362

Gene Name

vomeronasal 2, receptor 79

Synonyms

EG621430

MMRRC Submission

042648-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R5058 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86996465-87037968 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87002215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 274 (L274P)

Ref Sequence

ENSEMBL: ENSMUSP00000132478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164462]

AlphaFold

E9Q067

Predicted Effect

probably damaging
Transcript: ENSMUST00000164462
AA Change: L274P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: L274P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	75	464	1.9e-31	PFAM
Pfam:NCD3G	506	559	3.1e-21	PFAM
Pfam:7tm_3	592	827	2.8e-53	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.2%

Validation Efficiency

100% (79/79)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl1	T	C	8: 13,242,625	Y222C	probably damaging	Het
Adprhl2	A	G	4: 126,318,445	S94P	probably damaging	Het
Atp11b	A	G	3: 35,809,361	E202G	probably benign	Het
Cacna1d	G	T	14: 30,114,244	S849*	probably null	Het
Camsap1	T	C	2: 25,939,363	D783G	probably benign	Het
Cbfa2t2	T	A	2: 154,504,745	I124N	probably damaging	Het
Ccdc13	A	T	9: 121,817,547		probably benign	Het
Cfap44	G	A	16: 44,420,204		probably null	Het
Col17a1	C	A	19: 47,685,550	E13*	probably null	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dennd6b	A	G	15: 89,187,350	L288P	possibly damaging	Het
Dhx37	A	C	5: 125,422,231	Y638D	probably benign	Het
Epb41	G	A	4: 132,007,435		probably benign	Het
Esp31	A	T	17: 38,644,609	I48L	possibly damaging	Het
Fat3	T	C	9: 15,996,858	Q2616R	probably damaging	Het
Fbxo33	A	G	12: 59,219,133	I116T	probably benign	Het
Flnb	G	T	14: 7,924,262	E1792*	probably null	Het
Fzd2	G	A	11: 102,604,807	G26R	probably damaging	Het
Gm11677	T	A	11: 111,725,438		noncoding transcript	Het
Gm7137	A	T	10: 77,788,071		probably benign	Het
Hnrnpr	A	G	4: 136,336,337	T252A	possibly damaging	Het
Hyal5	T	C	6: 24,891,485	F433L	probably damaging	Het
Kcnmb4	T	A	10: 116,463,928		probably benign	Het
Meltf	A	G	16: 31,887,603		probably null	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Muc6	T	C	7: 141,644,224	D1213G	probably benign	Het
Ncam1	A	C	9: 49,798,695	F12C	probably benign	Het
Nfxl1	A	T	5: 72,556,239	D120E	probably benign	Het
Nrg1	T	C	8: 31,824,559	Q142R	probably damaging	Het
Olfr132	G	A	17: 38,130,541	S217F	probably damaging	Het
Olfr180	T	C	16: 58,916,072	T190A	probably benign	Het
Olfr250	C	A	9: 38,367,924	T116K	probably damaging	Het
Olfr347	T	G	2: 36,734,999	L226R	possibly damaging	Het
Olfr466	C	A	13: 65,152,929	A235D	possibly damaging	Het
Olfr684	T	C	7: 105,157,148	N178S	probably damaging	Het
Olfr948	C	A	9: 39,318,664	V317L	probably benign	Het
Olfr95	A	G	17: 37,211,667	L62P	probably damaging	Het
Padi2	G	T	4: 140,932,121	V246L	probably benign	Het
Pgghg	C	T	7: 140,942,542	T63I	possibly damaging	Het
Pitpnm1	A	G	19: 4,112,758	N1117S	probably benign	Het
Plch1	G	T	3: 63,722,781	T534K	probably damaging	Het
Poc1a	G	T	9: 106,349,813		probably benign	Het
Polr3c	T	C	3: 96,723,517	I196V	probably benign	Het
Prph	A	T	15: 99,055,232		probably benign	Het
Ptprg	C	A	14: 12,037,387	T189K	possibly damaging	Het
R3hcc1	A	T	14: 69,704,014	I183N	probably damaging	Het
Rundc1	T	C	11: 101,425,537	L145P	probably benign	Het
Slc26a3	A	G	12: 31,470,965	K723E	possibly damaging	Het
Slc38a3	T	C	9: 107,659,191	E2G	possibly damaging	Het
Slc9a5	G	T	8: 105,355,858	V252L	probably benign	Het
Smim26	C	T	2: 144,595,123	T64M	probably benign	Het
Socs4	C	T	14: 47,290,132	R175*	probably null	Het
Srebf2	T	C	15: 82,182,050	S600P	probably damaging	Het
Tas2r107	A	T	6: 131,659,742	S115T	probably damaging	Het
Tenm2	T	C	11: 36,207,080	D447G	possibly damaging	Het
Thbs2	T	A	17: 14,676,329	D766V	probably damaging	Het
Tinagl1	A	G	4: 130,167,457	V300A	probably benign	Het
Tle6	T	A	10: 81,594,238	N332I	possibly damaging	Het
Tle6	C	A	10: 81,595,957	W151L	probably damaging	Het
Tnfrsf13c	C	T	15: 82,224,207	V36M	probably damaging	Het
Tns2	T	C	15: 102,107,860	I211T	possibly damaging	Het
Trp63	A	G	16: 25,882,594	N379D	probably damaging	Het
Trpc2	T	C	7: 102,089,109	W433R	probably damaging	Het
Tyw1	T	A	5: 130,277,086	L350Q	probably benign	Het
Usf3	T	C	16: 44,212,707	L76P	probably damaging	Het

Other mutations in Vmn2r79

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01401:Vmn2r79	APN	7	87037273	missense	probably benign	0.01
IGL01675:Vmn2r79	APN	7	86996648	missense	probably benign	0.01
IGL01760:Vmn2r79	APN	7	87002158	missense	probably benign
IGL01834:Vmn2r79	APN	7	87037146	missense	probably benign	0.01
IGL01843:Vmn2r79	APN	7	87037277	missense	probably damaging	1.00
IGL01914:Vmn2r79	APN	7	87037363	missense	probably benign	0.14
IGL01980:Vmn2r79	APN	7	87037082	missense	possibly damaging	0.49
IGL02438:Vmn2r79	APN	7	87002536	missense	probably damaging	0.98
IGL02740:Vmn2r79	APN	7	87004158	missense	probably benign	0.00
IGL03052:Vmn2r79	UTSW	7	87003591	missense	probably benign	0.00
PIT4445001:Vmn2r79	UTSW	7	87002200	missense	possibly damaging	0.46
R0096:Vmn2r79	UTSW	7	87037319	missense	probably damaging	1.00
R0096:Vmn2r79	UTSW	7	87037319	missense	probably damaging	1.00
R0270:Vmn2r79	UTSW	7	87003386	missense	probably benign	0.00
R0336:Vmn2r79	UTSW	7	87002079	missense	probably benign	0.15
R0418:Vmn2r79	UTSW	7	87002403	missense	probably benign	0.18
R1070:Vmn2r79	UTSW	7	87003473	missense	probably damaging	1.00
R1234:Vmn2r79	UTSW	7	87004099	missense	possibly damaging	0.71
R1459:Vmn2r79	UTSW	7	87037794	missense	probably benign	0.01
R1513:Vmn2r79	UTSW	7	87037444	missense	probably benign	0.01
R1624:Vmn2r79	UTSW	7	87004039	critical splice acceptor site	probably null
R1633:Vmn2r79	UTSW	7	87037834	missense	possibly damaging	0.52
R1676:Vmn2r79	UTSW	7	87002631	missense	probably benign
R1781:Vmn2r79	UTSW	7	87002347	missense	probably benign	0.00
R1794:Vmn2r79	UTSW	7	87001413	missense	probably benign	0.37
R1823:Vmn2r79	UTSW	7	87037872	missense	probably damaging	1.00
R2013:Vmn2r79	UTSW	7	87004081	missense	possibly damaging	0.50
R2018:Vmn2r79	UTSW	7	87002426	missense	probably benign	0.07
R2019:Vmn2r79	UTSW	7	87002426	missense	probably benign	0.07
R2177:Vmn2r79	UTSW	7	86996631	missense	possibly damaging	0.94
R2984:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R3719:Vmn2r79	UTSW	7	87002037	missense	probably benign	0.05
R3798:Vmn2r79	UTSW	7	87002194	missense	possibly damaging	0.88
R3969:Vmn2r79	UTSW	7	87003593	missense	probably damaging	1.00
R4182:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4183:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4245:Vmn2r79	UTSW	7	87002416	missense	possibly damaging	0.73
R4301:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4391:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4393:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4394:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4396:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4397:Vmn2r79	UTSW	7	87001891	missense	possibly damaging	0.85
R4592:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
R4697:Vmn2r79	UTSW	7	87037960	missense	probably damaging	0.98
R4897:Vmn2r79	UTSW	7	87001467	missense	probably benign
R5016:Vmn2r79	UTSW	7	87037340	missense	probably benign	0.00
R5177:Vmn2r79	UTSW	7	87001969	missense	probably damaging	0.97
R6078:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
R6079:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
R6138:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
R6257:Vmn2r79	UTSW	7	87002570	missense	probably benign	0.27
R6260:Vmn2r79	UTSW	7	87037157	missense	probably benign	0.00
R6307:Vmn2r79	UTSW	7	87037768	missense	probably damaging	1.00
R6323:Vmn2r79	UTSW	7	87001314	missense	probably benign	0.05
R6374:Vmn2r79	UTSW	7	87002290	missense	probably benign	0.02
R6530:Vmn2r79	UTSW	7	87002044	missense	possibly damaging	0.91
R6546:Vmn2r79	UTSW	7	87003533	missense	probably benign	0.01
R6682:Vmn2r79	UTSW	7	87004162	missense	possibly damaging	0.69
R6858:Vmn2r79	UTSW	7	87037372	missense	probably benign
R6965:Vmn2r79	UTSW	7	87001892	missense	probably benign	0.10
R7130:Vmn2r79	UTSW	7	87002266	missense	probably damaging	0.99
R7156:Vmn2r79	UTSW	7	87037643	missense	probably damaging	0.98
R7604:Vmn2r79	UTSW	7	87003384	critical splice acceptor site	probably null
R7691:Vmn2r79	UTSW	7	87037903	missense	probably damaging	0.96
R8055:Vmn2r79	UTSW	7	87037333	missense	possibly damaging	0.94
R8070:Vmn2r79	UTSW	7	87002128	missense	probably benign
R8073:Vmn2r79	UTSW	7	87002254	missense	probably benign	0.00
R8145:Vmn2r79	UTSW	7	87037654	missense	probably benign	0.02
R8263:Vmn2r79	UTSW	7	87037518	missense	possibly damaging	0.89
R8350:Vmn2r79	UTSW	7	87037533	nonsense	probably null
R8400:Vmn2r79	UTSW	7	87002100	missense	probably benign	0.00
R8814:Vmn2r79	UTSW	7	87002506	missense	probably benign	0.00
R8862:Vmn2r79	UTSW	7	86996504	missense	probably benign	0.23
R9146:Vmn2r79	UTSW	7	87001473	nonsense	probably null
R9276:Vmn2r79	UTSW	7	87037837	missense	probably damaging	1.00
R9361:Vmn2r79	UTSW	7	87003614	critical splice donor site	probably null
R9676:Vmn2r79	UTSW	7	87037244	missense	probably damaging	1.00
U15987:Vmn2r79	UTSW	7	87004111	missense	possibly damaging	0.86
X0054:Vmn2r79	UTSW	7	87004062	missense	probably benign	0.01
Z1088:Vmn2r79	UTSW	7	87002341	missense	probably damaging	1.00
Z1176:Vmn2r79	UTSW	7	87002318	missense	probably benign	0.00
Z1176:Vmn2r79	UTSW	7	87037169	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTCCTTTCTGAATTGAGAGCAG -3'
(R):5'- GTCCACCACAGTTTAGCCAATG -3'

Sequencing Primer
(F):5'- CCTTTCTGAATTGAGAGCAGGAATG -3'
(R):5'- CCACAGTTTAGCCAATGAAATGTC -3'

Posted On

2016-06-06