Mutagenetix > Incidental Mutation

Incidental Mutation 'R5058:Adprhl1'

391024

Institutional Source

Beutler Lab

Gene Symbol

Adprhl1

Ensembl Gene

ENSMUSG00000031448

Gene Name

ADP-ribosylhydrolase like 1

Synonyms

Arh2, D330008N11Rik

MMRRC Submission

042648-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5058 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13221663-13254162 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13242625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 222 (Y222C)

Ref Sequence

ENSEMBL: ENSMUSP00000145145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]

AlphaFold

Q8BGK2

Predicted Effect

probably damaging
Transcript: ENSMUST00000033825
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: Y222C

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	1.2e-53	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166438

Predicted Effect

probably damaging
Transcript: ENSMUST00000168498
AA Change: Y167C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448
AA Change: Y167C

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	69	196	9e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171619

SMART Domains

Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	1	135	4.9e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204916
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: Y222C

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	4.2e-49	PFAM
low complexity region	509	527	N/A	INTRINSIC
low complexity region	955	969	N/A	INTRINSIC
internal_repeat_1	1047	1150	1.82e-5	PROSPERO
internal_repeat_1	1157	1274	1.82e-5	PROSPERO
low complexity region	1275	1290	N/A	INTRINSIC

Meta Mutation Damage Score

0.7491

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.2%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl2	A	G	4: 126,318,445	S94P	probably damaging	Het
Atp11b	A	G	3: 35,809,361	E202G	probably benign	Het
Cacna1d	G	T	14: 30,114,244	S849*	probably null	Het
Camsap1	T	C	2: 25,939,363	D783G	probably benign	Het
Cbfa2t2	T	A	2: 154,504,745	I124N	probably damaging	Het
Ccdc13	A	T	9: 121,817,547		probably benign	Het
Cfap44	G	A	16: 44,420,204		probably null	Het
Col17a1	C	A	19: 47,685,550	E13*	probably null	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dennd6b	A	G	15: 89,187,350	L288P	possibly damaging	Het
Dhx37	A	C	5: 125,422,231	Y638D	probably benign	Het
Epb41	G	A	4: 132,007,435		probably benign	Het
Esp31	A	T	17: 38,644,609	I48L	possibly damaging	Het
Fat3	T	C	9: 15,996,858	Q2616R	probably damaging	Het
Fbxo33	A	G	12: 59,219,133	I116T	probably benign	Het
Flnb	G	T	14: 7,924,262	E1792*	probably null	Het
Fzd2	G	A	11: 102,604,807	G26R	probably damaging	Het
Gm11677	T	A	11: 111,725,438		noncoding transcript	Het
Gm7137	A	T	10: 77,788,071		probably benign	Het
Hnrnpr	A	G	4: 136,336,337	T252A	possibly damaging	Het
Hyal5	T	C	6: 24,891,485	F433L	probably damaging	Het
Kcnmb4	T	A	10: 116,463,928		probably benign	Het
Meltf	A	G	16: 31,887,603		probably null	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Muc6	T	C	7: 141,644,224	D1213G	probably benign	Het
Ncam1	A	C	9: 49,798,695	F12C	probably benign	Het
Nfxl1	A	T	5: 72,556,239	D120E	probably benign	Het
Nrg1	T	C	8: 31,824,559	Q142R	probably damaging	Het
Olfr132	G	A	17: 38,130,541	S217F	probably damaging	Het
Olfr180	T	C	16: 58,916,072	T190A	probably benign	Het
Olfr250	C	A	9: 38,367,924	T116K	probably damaging	Het
Olfr347	T	G	2: 36,734,999	L226R	possibly damaging	Het
Olfr466	C	A	13: 65,152,929	A235D	possibly damaging	Het
Olfr684	T	C	7: 105,157,148	N178S	probably damaging	Het
Olfr948	C	A	9: 39,318,664	V317L	probably benign	Het
Olfr95	A	G	17: 37,211,667	L62P	probably damaging	Het
Padi2	G	T	4: 140,932,121	V246L	probably benign	Het
Pgghg	C	T	7: 140,942,542	T63I	possibly damaging	Het
Pitpnm1	A	G	19: 4,112,758	N1117S	probably benign	Het
Plch1	G	T	3: 63,722,781	T534K	probably damaging	Het
Poc1a	G	T	9: 106,349,813		probably benign	Het
Polr3c	T	C	3: 96,723,517	I196V	probably benign	Het
Prph	A	T	15: 99,055,232		probably benign	Het
Ptprg	C	A	14: 12,037,387	T189K	possibly damaging	Het
R3hcc1	A	T	14: 69,704,014	I183N	probably damaging	Het
Rundc1	T	C	11: 101,425,537	L145P	probably benign	Het
Slc26a3	A	G	12: 31,470,965	K723E	possibly damaging	Het
Slc38a3	T	C	9: 107,659,191	E2G	possibly damaging	Het
Slc9a5	G	T	8: 105,355,858	V252L	probably benign	Het
Smim26	C	T	2: 144,595,123	T64M	probably benign	Het
Socs4	C	T	14: 47,290,132	R175*	probably null	Het
Srebf2	T	C	15: 82,182,050	S600P	probably damaging	Het
Tas2r107	A	T	6: 131,659,742	S115T	probably damaging	Het
Tenm2	T	C	11: 36,207,080	D447G	possibly damaging	Het
Thbs2	T	A	17: 14,676,329	D766V	probably damaging	Het
Tinagl1	A	G	4: 130,167,457	V300A	probably benign	Het
Tle6	T	A	10: 81,594,238	N332I	possibly damaging	Het
Tle6	C	A	10: 81,595,957	W151L	probably damaging	Het
Tnfrsf13c	C	T	15: 82,224,207	V36M	probably damaging	Het
Tns2	T	C	15: 102,107,860	I211T	possibly damaging	Het
Trp63	A	G	16: 25,882,594	N379D	probably damaging	Het
Trpc2	T	C	7: 102,089,109	W433R	probably damaging	Het
Tyw1	T	A	5: 130,277,086	L350Q	probably benign	Het
Usf3	T	C	16: 44,212,707	L76P	probably damaging	Het
Vmn2r79	T	C	7: 87,002,215	L274P	probably damaging	Het

Other mutations in Adprhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03268:Adprhl1	APN	8	13246170	splice site	probably benign
BB003:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB004:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB005:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB006:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB013:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB014:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB015:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB016:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R0244:Adprhl1	UTSW	8	13242391	splice site	probably benign
R0636:Adprhl1	UTSW	8	13248702	missense	probably damaging	1.00
R1295:Adprhl1	UTSW	8	13248624	missense	probably damaging	1.00
R2111:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2112:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2184:Adprhl1	UTSW	8	13242559	missense	probably benign	0.00
R4411:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4412:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4413:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4615:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R4618:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R5016:Adprhl1	UTSW	8	13224889	missense	possibly damaging	0.88
R5060:Adprhl1	UTSW	8	13248621	missense	possibly damaging	0.63
R5209:Adprhl1	UTSW	8	13242563	nonsense	probably null
R6103:Adprhl1	UTSW	8	13222055	missense	possibly damaging	0.91
R6158:Adprhl1	UTSW	8	13224977	missense	possibly damaging	0.93
R6221:Adprhl1	UTSW	8	13225634	missense	probably benign	0.01
R6971:Adprhl1	UTSW	8	13223476	missense	probably benign
R7087:Adprhl1	UTSW	8	13221856	missense	probably damaging	0.99
R7362:Adprhl1	UTSW	8	13245534	missense	probably damaging	1.00
R7404:Adprhl1	UTSW	8	13225118	missense	probably damaging	0.99
R7422:Adprhl1	UTSW	8	13222873	missense	probably benign	0.28
R7439:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7441:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7772:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7773:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7774:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7776:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7876:Adprhl1	UTSW	8	13223509	missense	probably benign	0.00
R7877:Adprhl1	UTSW	8	13225316	nonsense	probably null
R7926:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7927:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7928:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7929:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7944:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7945:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7946:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7947:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7949:Adprhl1	UTSW	8	13224225	missense	possibly damaging	0.93
R8155:Adprhl1	UTSW	8	13221764	missense	probably damaging	0.99
R8182:Adprhl1	UTSW	8	13222774	missense	probably benign	0.07
R8753:Adprhl1	UTSW	8	13222118	missense	possibly damaging	0.91
R8799:Adprhl1	UTSW	8	13222474	missense	probably benign	0.00
R8893:Adprhl1	UTSW	8	13224511	missense	probably benign	0.11
R9022:Adprhl1	UTSW	8	13224352	missense	probably benign	0.00
R9161:Adprhl1	UTSW	8	13222270	missense	probably damaging	0.99
R9227:Adprhl1	UTSW	8	13221974	missense	probably benign	0.27
R9228:Adprhl1	UTSW	8	13225279	missense	probably benign
R9283:Adprhl1	UTSW	8	13223540	missense	probably benign
R9426:Adprhl1	UTSW	8	13224034	missense	possibly damaging	0.93
R9648:Adprhl1	UTSW	8	13223245	missense	probably benign	0.40
Z1176:Adprhl1	UTSW	8	13225613	missense	probably benign	0.01
Z1177:Adprhl1	UTSW	8	13245476	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ACTGTGAGTCCAAGAAAAGAGTCC -3'
(R):5'- ACTGCCTGTGCTACTTCTGG -3'

Sequencing Primer
(F):5'- AGAGTCCAGTCCATCCCTG -3'
(R):5'- CCTGTGCTACTTCTGGAAGCAG -3'

Posted On

2016-06-06