Incidental Mutation 'R5058:Tle6'
ID391034
Institutional Source Beutler Lab
Gene Symbol Tle6
Ensembl Gene ENSMUSG00000034758
Gene Nametransducin-like enhancer of split 6
Synonyms1810057E06Rik, Grg6
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5058 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81590904-81601073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81594238 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 332 (N332I)
Ref Sequence ENSEMBL: ENSMUSP00000117287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072020] [ENSMUST00000127546] [ENSMUST00000135211] [ENSMUST00000142948] [ENSMUST00000146358] [ENSMUST00000146916] [ENSMUST00000151858]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072020
AA Change: N342I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071905
Gene: ENSMUSG00000034758
AA Change: N342I

DomainStartEndE-ValueType
WD40 283 320 9.6e-2 SMART
Blast:WD40 334 372 2e-12 BLAST
WD40 377 415 6.16e0 SMART
WD40 418 455 7.43e-1 SMART
Blast:WD40 460 496 4e-13 BLAST
WD40 499 538 1.43e0 SMART
WD40 541 578 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124724
Predicted Effect probably benign
Transcript: ENSMUST00000124854
SMART Domains Protein: ENSMUSP00000118334
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Blast:WD40 6 44 9e-20 BLAST
WD40 46 85 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect probably benign
Transcript: ENSMUST00000131411
SMART Domains Protein: ENSMUSP00000114400
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
WD40 36 75 1.2e-2 SMART
WD40 76 116 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135008
Predicted Effect probably benign
Transcript: ENSMUST00000135211
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect possibly damaging
Transcript: ENSMUST00000142948
AA Change: N332I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117287
Gene: ENSMUSG00000034758
AA Change: N332I

DomainStartEndE-ValueType
WD40 273 310 9.6e-2 SMART
Blast:WD40 324 362 2e-12 BLAST
WD40 367 405 6.16e0 SMART
WD40 408 445 7.43e-1 SMART
Blast:WD40 450 486 4e-13 BLAST
WD40 489 528 1.43e0 SMART
WD40 531 568 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146239
Predicted Effect probably benign
Transcript: ENSMUST00000146358
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146916
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149721
Predicted Effect probably benign
Transcript: ENSMUST00000151858
SMART Domains Protein: ENSMUSP00000119945
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153812
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Groucho/ transducin-like Enhancer of split family of transcriptional co-repressors. The encoded protein is a component of the mammalian subcortical maternal complex, which is required for preimplantation development. In mouse, knock out of this gene results in cleavage-stage embryonic arrest resulting from defective cytoplasmic F-actin meshwork formation and asymmetric cell division. In human, an allelic variant in this gene is associated with preimplantation embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Tle6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tle6 APN 10 81594458 missense probably damaging 1.00
IGL02151:Tle6 APN 10 81598640 missense probably benign 0.01
IGL02724:Tle6 APN 10 81600064 nonsense probably null
R0420:Tle6 UTSW 10 81595311 unclassified probably benign
R0423:Tle6 UTSW 10 81598623 missense possibly damaging 0.95
R0589:Tle6 UTSW 10 81595419 unclassified probably benign
R0605:Tle6 UTSW 10 81594346 missense probably damaging 0.99
R1554:Tle6 UTSW 10 81595385 missense probably benign 0.05
R1860:Tle6 UTSW 10 81594329 missense probably damaging 1.00
R1863:Tle6 UTSW 10 81591921 missense possibly damaging 0.91
R1952:Tle6 UTSW 10 81595485 missense possibly damaging 0.82
R2139:Tle6 UTSW 10 81594034 missense probably damaging 0.99
R2337:Tle6 UTSW 10 81592656 unclassified probably null
R2849:Tle6 UTSW 10 81594401 missense probably damaging 1.00
R3158:Tle6 UTSW 10 81595204 splice site probably null
R3777:Tle6 UTSW 10 81596153 missense probably benign 0.23
R3778:Tle6 UTSW 10 81596153 missense probably benign 0.23
R4085:Tle6 UTSW 10 81594515 unclassified probably null
R5058:Tle6 UTSW 10 81595957 missense probably damaging 1.00
R5183:Tle6 UTSW 10 81592801 missense probably damaging 0.97
R6225:Tle6 UTSW 10 81592766 missense probably damaging 1.00
R6331:Tle6 UTSW 10 81595239 missense probably benign 0.00
R6514:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R6515:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R6517:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R7145:Tle6 UTSW 10 81600076 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCAAGGGCCATGTTTTCCTTTG -3'
(R):5'- AGGAACTGCTATTGGTGGTAGC -3'

Sequencing Primer
(F):5'- CCTTTGTGTTGGCCAGTGC -3'
(R):5'- TCTTCACCTGCAGCCAGAG -3'
Posted On2016-06-06