Incidental Mutation 'R5058:Tenm2'
ID391037
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Nameteneurin transmembrane protein 2
Synonyms2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #R5058 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location36006656-37235964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36207080 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 447 (D447G)
Ref Sequence ENSEMBL: ENSMUSP00000129951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057207
AA Change: D447G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: D447G

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102801
AA Change: D447G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: D447G

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155147
Predicted Effect possibly damaging
Transcript: ENSMUST00000163524
AA Change: D447G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: D447G

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Meta Mutation Damage Score 0.3428 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36206899 splice site probably benign
IGL00834:Tenm2 APN 11 36024258 missense probably damaging 1.00
IGL00911:Tenm2 APN 11 36008733 nonsense probably null
IGL00937:Tenm2 APN 11 36024623 missense probably damaging 1.00
IGL01154:Tenm2 APN 11 36041544 missense probably damaging 1.00
IGL01313:Tenm2 APN 11 36024248 missense probably damaging 0.98
IGL01346:Tenm2 APN 11 36027405 nonsense probably null
IGL01539:Tenm2 APN 11 36106827 missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36864884 missense probably damaging 0.98
IGL01780:Tenm2 APN 11 36046941 missense probably benign
IGL01821:Tenm2 APN 11 36023883 missense probably damaging 0.98
IGL01988:Tenm2 APN 11 36027251 missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36207095 missense probably benign
IGL02449:Tenm2 APN 11 36023622 missense probably damaging 0.99
IGL02505:Tenm2 APN 11 36051916 nonsense probably null
IGL02649:Tenm2 APN 11 36207085 missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 36068458 missense probably benign 0.05
IGL02801:Tenm2 APN 11 36047030 nonsense probably null
IGL02928:Tenm2 APN 11 36027170 missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 36041644 missense probably damaging 1.00
IGL03202:Tenm2 APN 11 36024548 missense probably damaging 1.00
IGL03213:Tenm2 APN 11 36023330 missense probably benign 0.05
IGL03276:Tenm2 APN 11 36072776 missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 36052025 splice site probably null
IGL03381:Tenm2 APN 11 36068411 missense probably benign 0.01
IGL03398:Tenm2 APN 11 36024543 missense probably damaging 1.00
browser UTSW 11 36046765 critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36273408 missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 36063902 missense probably damaging 0.99
R0004:Tenm2 UTSW 11 36023357 missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36207124 splice site probably benign
R0537:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
R0599:Tenm2 UTSW 11 36024780 missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36943976 missense probably damaging 1.00
R0693:Tenm2 UTSW 11 36024809 missense probably damaging 1.00
R0991:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36864684 missense probably benign 0.30
R1177:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 36008358 missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 36041659 missense probably damaging 1.00
R1272:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 36068594 splice site probably benign
R1374:Tenm2 UTSW 11 36008454 missense probably benign 0.00
R1542:Tenm2 UTSW 11 36300220 missense probably damaging 0.99
R1573:Tenm2 UTSW 11 36047069 missense probably damaging 1.00
R1579:Tenm2 UTSW 11 36106783 missense probably damaging 1.00
R1697:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 36008103 missense probably damaging 1.00
R1756:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 36023382 missense probably damaging 0.99
R1950:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 36047547 missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 36047264 nonsense probably null
R2117:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36864862 missense probably damaging 0.98
R2298:Tenm2 UTSW 11 36046777 missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 36027191 missense probably damaging 1.00
R3014:Tenm2 UTSW 11 36023973 missense probably damaging 1.00
R3115:Tenm2 UTSW 11 36023366 missense probably damaging 1.00
R3684:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3685:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3705:Tenm2 UTSW 11 36068326 missense probably damaging 0.97
R3820:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3821:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3822:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3844:Tenm2 UTSW 11 36047538 missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36139574 critical splice donor site probably null
R4019:Tenm2 UTSW 11 36047074 missense probably benign 0.04
R4062:Tenm2 UTSW 11 36008655 missense probably damaging 1.00
R4367:Tenm2 UTSW 11 36027398 missense probably benign
R4395:Tenm2 UTSW 11 36024624 missense probably benign 0.23
R4508:Tenm2 UTSW 11 36008345 missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 36063104 missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 36046780 missense probably damaging 1.00
R4644:Tenm2 UTSW 11 36047136 missense probably benign 0.00
R4661:Tenm2 UTSW 11 36024448 missense probably damaging 0.99
R4669:Tenm2 UTSW 11 36010487 missense probably damaging 1.00
R4687:Tenm2 UTSW 11 36049097 missense probably benign
R4711:Tenm2 UTSW 11 36300212 missense probably damaging 0.98
R4816:Tenm2 UTSW 11 36027290 missense probably damaging 1.00
R4843:Tenm2 UTSW 11 36024020 missense probably damaging 1.00
R4850:Tenm2 UTSW 11 36023488 nonsense probably null
R4870:Tenm2 UTSW 11 36078569 missense probably damaging 1.00
R5071:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5073:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5074:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5081:Tenm2 UTSW 11 36024633 missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36944162 missense probably damaging 1.00
R5170:Tenm2 UTSW 11 36024806 missense probably damaging 0.98
R5253:Tenm2 UTSW 11 36047201 nonsense probably null
R5343:Tenm2 UTSW 11 36069503 missense probably benign 0.00
R5493:Tenm2 UTSW 11 36864676 missense probably benign 0.01
R5600:Tenm2 UTSW 11 36163714 splice site probably null
R5677:Tenm2 UTSW 11 36141683 missense probably damaging 0.98
R5703:Tenm2 UTSW 11 36023799 missense probably benign 0.34
R5707:Tenm2 UTSW 11 36047182 missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 36072729 critical splice donor site probably null
R6063:Tenm2 UTSW 11 36163717 critical splice donor site probably null
R6086:Tenm2 UTSW 11 36008646 missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 36008783 missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36139690 missense probably damaging 0.99
R6193:Tenm2 UTSW 11 36046794 missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36864859 missense probably benign 0.44
R6477:Tenm2 UTSW 11 36010507 critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 36063775 critical splice donor site probably null
R6668:Tenm2 UTSW 11 36046765 critical splice donor site probably null
R6825:Tenm2 UTSW 11 36046884 missense probably benign 0.02
R6885:Tenm2 UTSW 11 36023580 missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36171409 missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36163817 missense probably damaging 0.99
R7153:Tenm2 UTSW 11 36024182 missense probably damaging 0.98
R7173:Tenm2 UTSW 11 36041551 missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36171436 missense probably damaging 1.00
R7205:Tenm2 UTSW 11 36049129 missense probably damaging 0.99
R7250:Tenm2 UTSW 11 36072798 missense probably damaging 1.00
R7290:Tenm2 UTSW 11 36023471 missense probably damaging 1.00
R7366:Tenm2 UTSW 11 36069414 missense probably benign 0.09
R7432:Tenm2 UTSW 11 36864941 missense probably benign
R7504:Tenm2 UTSW 11 36139743 missense probably damaging 1.00
R7513:Tenm2 UTSW 11 36051900 missense probably benign 0.34
R7523:Tenm2 UTSW 11 36078581 splice site probably null
R7527:Tenm2 UTSW 11 36206976 missense probably damaging 1.00
R7648:Tenm2 UTSW 11 36106736 missense probably damaging 1.00
R7653:Tenm2 UTSW 11 36047347 missense probably benign 0.09
R7717:Tenm2 UTSW 11 36864935 missense probably damaging 0.97
R7739:Tenm2 UTSW 11 36069561 missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 36023306 missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 36010449 missense probably damaging 0.99
R7803:Tenm2 UTSW 11 36047116 missense probably damaging 0.98
RF021:Tenm2 UTSW 11 36024203 missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 36024200 missense probably damaging 1.00
X0063:Tenm2 UTSW 11 36024730 missense probably benign
Z1088:Tenm2 UTSW 11 36273267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTGTGGCCATACCTG -3'
(R):5'- AAAAGCACTGTGCCAGGGTC -3'

Sequencing Primer
(F):5'- CATACCTGGGCATGAGACG -3'
(R):5'- ACTGTGCCAGGGTCTCAGATG -3'
Posted On2016-06-06