Mutagenetix > Incidental Mutation

Incidental Mutation 'R5058:Olfr466'

391044

Institutional Source

Beutler Lab

Gene Symbol

Olfr466

Ensembl Gene

ENSMUSG00000049806

Gene Name

olfactory receptor 466

Synonyms

GA_x6K02T2PB7A-3051266-3052192, MOR209-1

MMRRC Submission

042648-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R5058 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65150240-65156152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 65152929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 235 (A235D)

Ref Sequence

ENSEMBL: ENSMUSP00000149328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058907] [ENSMUST00000214214]

AlphaFold

E9Q2B9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058907
AA Change: A235D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000062692
Gene: ENSMUSG00000049806
AA Change: A235D

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	305	2.8e-47	PFAM
Pfam:7tm_1	39	288	3.2e-18	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214214
AA Change: A235D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.2%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl1	T	C	8: 13,242,625	Y222C	probably damaging	Het
Adprhl2	A	G	4: 126,318,445	S94P	probably damaging	Het
Atp11b	A	G	3: 35,809,361	E202G	probably benign	Het
Cacna1d	G	T	14: 30,114,244	S849*	probably null	Het
Camsap1	T	C	2: 25,939,363	D783G	probably benign	Het
Cbfa2t2	T	A	2: 154,504,745	I124N	probably damaging	Het
Ccdc13	A	T	9: 121,817,547		probably benign	Het
Cfap44	G	A	16: 44,420,204		probably null	Het
Col17a1	C	A	19: 47,685,550	E13*	probably null	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dennd6b	A	G	15: 89,187,350	L288P	possibly damaging	Het
Dhx37	A	C	5: 125,422,231	Y638D	probably benign	Het
Epb41	G	A	4: 132,007,435		probably benign	Het
Esp31	A	T	17: 38,644,609	I48L	possibly damaging	Het
Fat3	T	C	9: 15,996,858	Q2616R	probably damaging	Het
Fbxo33	A	G	12: 59,219,133	I116T	probably benign	Het
Flnb	G	T	14: 7,924,262	E1792*	probably null	Het
Fzd2	G	A	11: 102,604,807	G26R	probably damaging	Het
Gm11677	T	A	11: 111,725,438		noncoding transcript	Het
Gm7137	A	T	10: 77,788,071		probably benign	Het
Hnrnpr	A	G	4: 136,336,337	T252A	possibly damaging	Het
Hyal5	T	C	6: 24,891,485	F433L	probably damaging	Het
Kcnmb4	T	A	10: 116,463,928		probably benign	Het
Meltf	A	G	16: 31,887,603		probably null	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Muc6	T	C	7: 141,644,224	D1213G	probably benign	Het
Ncam1	A	C	9: 49,798,695	F12C	probably benign	Het
Nfxl1	A	T	5: 72,556,239	D120E	probably benign	Het
Nrg1	T	C	8: 31,824,559	Q142R	probably damaging	Het
Olfr132	G	A	17: 38,130,541	S217F	probably damaging	Het
Olfr180	T	C	16: 58,916,072	T190A	probably benign	Het
Olfr250	C	A	9: 38,367,924	T116K	probably damaging	Het
Olfr347	T	G	2: 36,734,999	L226R	possibly damaging	Het
Olfr684	T	C	7: 105,157,148	N178S	probably damaging	Het
Olfr948	C	A	9: 39,318,664	V317L	probably benign	Het
Olfr95	A	G	17: 37,211,667	L62P	probably damaging	Het
Padi2	G	T	4: 140,932,121	V246L	probably benign	Het
Pgghg	C	T	7: 140,942,542	T63I	possibly damaging	Het
Pitpnm1	A	G	19: 4,112,758	N1117S	probably benign	Het
Plch1	G	T	3: 63,722,781	T534K	probably damaging	Het
Poc1a	G	T	9: 106,349,813		probably benign	Het
Polr3c	T	C	3: 96,723,517	I196V	probably benign	Het
Prph	A	T	15: 99,055,232		probably benign	Het
Ptprg	C	A	14: 12,037,387	T189K	possibly damaging	Het
R3hcc1	A	T	14: 69,704,014	I183N	probably damaging	Het
Rundc1	T	C	11: 101,425,537	L145P	probably benign	Het
Slc26a3	A	G	12: 31,470,965	K723E	possibly damaging	Het
Slc38a3	T	C	9: 107,659,191	E2G	possibly damaging	Het
Slc9a5	G	T	8: 105,355,858	V252L	probably benign	Het
Smim26	C	T	2: 144,595,123	T64M	probably benign	Het
Socs4	C	T	14: 47,290,132	R175*	probably null	Het
Srebf2	T	C	15: 82,182,050	S600P	probably damaging	Het
Tas2r107	A	T	6: 131,659,742	S115T	probably damaging	Het
Tenm2	T	C	11: 36,207,080	D447G	possibly damaging	Het
Thbs2	T	A	17: 14,676,329	D766V	probably damaging	Het
Tinagl1	A	G	4: 130,167,457	V300A	probably benign	Het
Tle6	T	A	10: 81,594,238	N332I	possibly damaging	Het
Tle6	C	A	10: 81,595,957	W151L	probably damaging	Het
Tnfrsf13c	C	T	15: 82,224,207	V36M	probably damaging	Het
Tns2	T	C	15: 102,107,860	I211T	possibly damaging	Het
Trp63	A	G	16: 25,882,594	N379D	probably damaging	Het
Trpc2	T	C	7: 102,089,109	W433R	probably damaging	Het
Tyw1	T	A	5: 130,277,086	L350Q	probably benign	Het
Usf3	T	C	16: 44,212,707	L76P	probably damaging	Het
Vmn2r79	T	C	7: 87,002,215	L274P	probably damaging	Het

Other mutations in Olfr466

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02684:Olfr466	APN	13	65152396	missense	probably damaging	0.99
R0269:Olfr466	UTSW	13	65152878	missense	possibly damaging	0.56
R0617:Olfr466	UTSW	13	65152878	missense	possibly damaging	0.56
R0646:Olfr466	UTSW	13	65153063	missense	probably damaging	1.00
R1338:Olfr466	UTSW	13	65152383	missense	probably damaging	1.00
R1893:Olfr466	UTSW	13	65152992	missense	possibly damaging	0.92
R3108:Olfr466	UTSW	13	65153061	missense	possibly damaging	0.89
R4408:Olfr466	UTSW	13	65152700	missense	probably benign	0.00
R4625:Olfr466	UTSW	13	65152860	missense	possibly damaging	0.95
R4732:Olfr466	UTSW	13	65152653	missense	possibly damaging	0.72
R4733:Olfr466	UTSW	13	65152653	missense	possibly damaging	0.72
R4849:Olfr466	UTSW	13	65152679	missense	possibly damaging	0.96
R5419:Olfr466	UTSW	13	65152774	missense	probably damaging	1.00
R5569:Olfr466	UTSW	13	65152979	missense	possibly damaging	0.81
R5662:Olfr466	UTSW	13	65152253	missense	possibly damaging	0.76
R7292:Olfr466	UTSW	13	65152842	missense	possibly damaging	0.94
R7345:Olfr466	UTSW	13	65152743	missense	possibly damaging	0.59
R7427:Olfr466	UTSW	13	65153052	missense	probably damaging	1.00
R7428:Olfr466	UTSW	13	65153052	missense	probably damaging	1.00
R8162:Olfr466	UTSW	13	65152920	missense	probably damaging	0.99
R8736:Olfr466	UTSW	13	65152724	missense	probably damaging	1.00
R9224:Olfr466	UTSW	13	65152389	missense	probably damaging	1.00
R9607:Olfr466	UTSW	13	65153071	missense	probably benign	0.33
R9739:Olfr466	UTSW	13	65152628	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAATGCTGTCACGCAAACC -3'
(R):5'- GACATCTTTGTTCCTCAGGCTG -3'

Sequencing Primer
(F):5'- GTGGGTCCAATGAGATCAATGACTTC -3'
(R):5'- CAGGCTGTATATGAGGGGGTTCAAC -3'

Posted On

2016-06-06