Incidental Mutation 'R5058:Tnfrsf13c'
ID391051
Institutional Source Beutler Lab
Gene Symbol Tnfrsf13c
Ensembl Gene ENSMUSG00000068105
Gene Nametumor necrosis factor receptor superfamily, member 13c
Synonyms2010006P15Rik, Bcmd1, Lvis22, Bcmd-1, Baffr, BAFF-R
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5058 (G1)
Quality Score126
Status Validated
Chromosome15
Chromosomal Location82221743-82224369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82224207 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 36 (V36M)
Ref Sequence ENSEMBL: ENSMUSP00000154899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089161] [ENSMUST00000109535] [ENSMUST00000231049]
Predicted Effect probably damaging
Transcript: ENSMUST00000089161
AA Change: V36M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086564
Gene: ENSMUSG00000068105
AA Change: V36M

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:BaffR-Tall_bind 19 49 2.4e-25 PFAM
transmembrane domain 73 95 N/A INTRINSIC
PDB:2GKW|B 152 175 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000109535
AA Change: V36M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105161
Gene: ENSMUSG00000068105
AA Change: V36M

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:BaffR-Tall_bind 19 49 5.4e-26 PFAM
transmembrane domain 109 131 N/A INTRINSIC
PDB:2GKW|B 177 200 2e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000229984
Predicted Effect probably damaging
Transcript: ENSMUST00000231049
AA Change: V36M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B cell-activating factor (BAFF) enhances B-cell survival in vitro and is a regulator of the peripheral B-cell population. Overexpression of Baff in mice results in mature B-cell hyperplasia and symptoms of systemic lupus erythematosus (SLE). Also, some SLE patients have increased levels of BAFF in serum. Therefore, it has been proposed that abnormally high levels of BAFF may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells. The protein encoded by this gene is a receptor for BAFF and is a type III transmembrane protein containing a single extracellular cysteine-rich domain. It is thought that this receptor is the principal receptor required for BAFF-mediated mature B-cell survival. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in defective splenic B-cell maturation, reduced marginal zone B-cell numbers, and impaired T-cell-dependent antibody formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Tnfrsf13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02222:Tnfrsf13c APN 15 82223163 missense probably damaging 0.98
IGL02608:Tnfrsf13c APN 15 82223163 missense probably damaging 1.00
IGL03378:Tnfrsf13c APN 15 82224312 start codon destroyed probably benign 0.14
Tannin UTSW 15 82224207 missense probably damaging 1.00
Teton_range UTSW 15 82223154 missense probably damaging 0.98
R6092:Tnfrsf13c UTSW 15 82223154 missense probably damaging 0.98
R6296:Tnfrsf13c UTSW 15 82223902 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCCTTCTGAAGTGTCTGGG -3'
(R):5'- TCATTCTAGACTACAGGGCACAC -3'

Sequencing Primer
(F):5'- AGTATCAGTCCCAGGAGTGC -3'
(R):5'- CAGCCCAGACTCGGAACTGTC -3'
Posted On2016-06-06