Mutagenetix > Incidental Mutation

Incidental Mutation 'R5058:Trp63'

391055

Institutional Source

Beutler Lab

Gene Symbol

Trp63

Ensembl Gene

ENSMUSG00000022510

Gene Name

transformation related protein 63

Synonyms

TAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1

MMRRC Submission

042648-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R5058 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25683763-25892102 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25882594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 379 (N379D)

Ref Sequence

ENSEMBL: ENSMUSP00000038117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115306] [ENSMUST00000115310]

AlphaFold

O88898

Predicted Effect

probably damaging
Transcript: ENSMUST00000040231
AA Change: N379D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510
AA Change: N379D

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	5.4e-110	PFAM
Pfam:P53_tetramer	297	338	2.4e-20	PFAM
low complexity region	343	356	N/A	INTRINSIC
low complexity region	358	369	N/A	INTRINSIC
SAM	447	513	1.4e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065523
AA Change: N473D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510
AA Change: N473D

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	4.9e-110	PFAM
Pfam:P53_tetramer	391	432	2.2e-20	PFAM
low complexity region	437	450	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115306
AA Change: N375D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510
AA Change: N375D

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	2.7e-110	PFAM
Pfam:P53_tetramer	293	334	9.2e-21	PFAM
low complexity region	339	352	N/A	INTRINSIC
low complexity region	354	365	N/A	INTRINSIC
SAM	443	509	1.4e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115310
AA Change: N473D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510
AA Change: N473D

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	1.3e-112	PFAM
Pfam:P53_tetramer	391	431	7e-21	PFAM
low complexity region	437	450	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC
SAM	541	607	1.4e-7	SMART

Meta Mutation Damage Score

0.3820

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.2%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl1	T	C	8: 13,242,625	Y222C	probably damaging	Het
Adprhl2	A	G	4: 126,318,445	S94P	probably damaging	Het
Atp11b	A	G	3: 35,809,361	E202G	probably benign	Het
Cacna1d	G	T	14: 30,114,244	S849*	probably null	Het
Camsap1	T	C	2: 25,939,363	D783G	probably benign	Het
Cbfa2t2	T	A	2: 154,504,745	I124N	probably damaging	Het
Ccdc13	A	T	9: 121,817,547		probably benign	Het
Cfap44	G	A	16: 44,420,204		probably null	Het
Col17a1	C	A	19: 47,685,550	E13*	probably null	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dennd6b	A	G	15: 89,187,350	L288P	possibly damaging	Het
Dhx37	A	C	5: 125,422,231	Y638D	probably benign	Het
Epb41	G	A	4: 132,007,435		probably benign	Het
Esp31	A	T	17: 38,644,609	I48L	possibly damaging	Het
Fat3	T	C	9: 15,996,858	Q2616R	probably damaging	Het
Fbxo33	A	G	12: 59,219,133	I116T	probably benign	Het
Flnb	G	T	14: 7,924,262	E1792*	probably null	Het
Fzd2	G	A	11: 102,604,807	G26R	probably damaging	Het
Gm11677	T	A	11: 111,725,438		noncoding transcript	Het
Gm7137	A	T	10: 77,788,071		probably benign	Het
Hnrnpr	A	G	4: 136,336,337	T252A	possibly damaging	Het
Hyal5	T	C	6: 24,891,485	F433L	probably damaging	Het
Kcnmb4	T	A	10: 116,463,928		probably benign	Het
Meltf	A	G	16: 31,887,603		probably null	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Muc6	T	C	7: 141,644,224	D1213G	probably benign	Het
Ncam1	A	C	9: 49,798,695	F12C	probably benign	Het
Nfxl1	A	T	5: 72,556,239	D120E	probably benign	Het
Nrg1	T	C	8: 31,824,559	Q142R	probably damaging	Het
Olfr132	G	A	17: 38,130,541	S217F	probably damaging	Het
Olfr180	T	C	16: 58,916,072	T190A	probably benign	Het
Olfr250	C	A	9: 38,367,924	T116K	probably damaging	Het
Olfr347	T	G	2: 36,734,999	L226R	possibly damaging	Het
Olfr466	C	A	13: 65,152,929	A235D	possibly damaging	Het
Olfr684	T	C	7: 105,157,148	N178S	probably damaging	Het
Olfr948	C	A	9: 39,318,664	V317L	probably benign	Het
Olfr95	A	G	17: 37,211,667	L62P	probably damaging	Het
Padi2	G	T	4: 140,932,121	V246L	probably benign	Het
Pgghg	C	T	7: 140,942,542	T63I	possibly damaging	Het
Pitpnm1	A	G	19: 4,112,758	N1117S	probably benign	Het
Plch1	G	T	3: 63,722,781	T534K	probably damaging	Het
Poc1a	G	T	9: 106,349,813		probably benign	Het
Polr3c	T	C	3: 96,723,517	I196V	probably benign	Het
Prph	A	T	15: 99,055,232		probably benign	Het
Ptprg	C	A	14: 12,037,387	T189K	possibly damaging	Het
R3hcc1	A	T	14: 69,704,014	I183N	probably damaging	Het
Rundc1	T	C	11: 101,425,537	L145P	probably benign	Het
Slc26a3	A	G	12: 31,470,965	K723E	possibly damaging	Het
Slc38a3	T	C	9: 107,659,191	E2G	possibly damaging	Het
Slc9a5	G	T	8: 105,355,858	V252L	probably benign	Het
Smim26	C	T	2: 144,595,123	T64M	probably benign	Het
Socs4	C	T	14: 47,290,132	R175*	probably null	Het
Srebf2	T	C	15: 82,182,050	S600P	probably damaging	Het
Tas2r107	A	T	6: 131,659,742	S115T	probably damaging	Het
Tenm2	T	C	11: 36,207,080	D447G	possibly damaging	Het
Thbs2	T	A	17: 14,676,329	D766V	probably damaging	Het
Tinagl1	A	G	4: 130,167,457	V300A	probably benign	Het
Tle6	T	A	10: 81,594,238	N332I	possibly damaging	Het
Tle6	C	A	10: 81,595,957	W151L	probably damaging	Het
Tnfrsf13c	C	T	15: 82,224,207	V36M	probably damaging	Het
Tns2	T	C	15: 102,107,860	I211T	possibly damaging	Het
Trpc2	T	C	7: 102,089,109	W433R	probably damaging	Het
Tyw1	T	A	5: 130,277,086	L350Q	probably benign	Het
Usf3	T	C	16: 44,212,707	L76P	probably damaging	Het
Vmn2r79	T	C	7: 87,002,215	L274P	probably damaging	Het

Other mutations in Trp63

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00935:Trp63	APN	16	25871076	missense	probably damaging	1.00
IGL01402:Trp63	APN	16	25820385	splice site	probably benign
IGL01404:Trp63	APN	16	25820385	splice site	probably benign
IGL01874:Trp63	APN	16	25882585	missense	possibly damaging	0.88
IGL01887:Trp63	APN	16	25865319	missense	probably damaging	1.00
IGL02008:Trp63	APN	16	25862461	missense	probably damaging	1.00
IGL02336:Trp63	APN	16	25820442	missense	probably damaging	1.00
IGL02470:Trp63	APN	16	25820384	splice site	probably benign
IGL02720:Trp63	APN	16	25863741	missense	probably damaging	0.96
IGL03230:Trp63	APN	16	25889010	missense	probably damaging	1.00
PIT4142001:Trp63	UTSW	16	25865263	missense	probably damaging	1.00
R0086:Trp63	UTSW	16	25871087	missense	probably damaging	1.00
R0281:Trp63	UTSW	16	25764302	splice site	probably benign
R1448:Trp63	UTSW	16	25889120	missense	possibly damaging	0.67
R1517:Trp63	UTSW	16	25889253	missense	probably damaging	1.00
R1539:Trp63	UTSW	16	25884849	missense	probably benign	0.02
R3922:Trp63	UTSW	16	25889009	missense	probably damaging	1.00
R3977:Trp63	UTSW	16	25820740	intron	probably benign
R3978:Trp63	UTSW	16	25820740	intron	probably benign
R3979:Trp63	UTSW	16	25820740	intron	probably benign
R4689:Trp63	UTSW	16	25865262	missense	possibly damaging	0.90
R4870:Trp63	UTSW	16	25866218	makesense	probably null
R5009:Trp63	UTSW	16	25868227	missense	probably damaging	0.99
R5033:Trp63	UTSW	16	25763306	missense	probably damaging	0.99
R5118:Trp63	UTSW	16	25889010	missense	unknown
R5354:Trp63	UTSW	16	25684355	splice site	probably null
R5363:Trp63	UTSW	16	25863718	missense	probably damaging	0.99
R5668:Trp63	UTSW	16	25866185	missense	possibly damaging	0.52
R6004:Trp63	UTSW	16	25763396	critical splice donor site	probably null
R6029:Trp63	UTSW	16	25868214	missense	probably damaging	1.00
R6170:Trp63	UTSW	16	25884853	missense	probably benign	0.28
R6186:Trp63	UTSW	16	25876733	intron	probably benign
R6266:Trp63	UTSW	16	25862460	missense	probably damaging	0.99
R6466:Trp63	UTSW	16	25763358	missense	probably damaging	1.00
R6486:Trp63	UTSW	16	25865340	missense	probably damaging	0.99
R6913:Trp63	UTSW	16	25889168	missense	probably damaging	1.00
R6980:Trp63	UTSW	16	25802093	missense	probably benign
R7097:Trp63	UTSW	16	25820477	missense	probably damaging	1.00
R7122:Trp63	UTSW	16	25820477	missense	probably damaging	1.00
R7544:Trp63	UTSW	16	25802087	missense	probably benign
R7690:Trp63	UTSW	16	25876733	missense	unknown
R7743:Trp63	UTSW	16	25882625	missense	probably benign	0.05
R7766:Trp63	UTSW	16	25868219	missense	probably damaging	0.97
R7792:Trp63	UTSW	16	25868224	missense	possibly damaging	0.94
R7816:Trp63	UTSW	16	25889240	missense	probably damaging	1.00
R7978:Trp63	UTSW	16	25820686	missense	unknown
R8324:Trp63	UTSW	16	25876734	missense	unknown
R8857:Trp63	UTSW	16	25820476	missense	probably damaging	1.00
R9041:Trp63	UTSW	16	25763333	missense	probably benign
R9123:Trp63	UTSW	16	25820497	missense	probably damaging	1.00
R9491:Trp63	UTSW	16	25876722	missense	unknown
R9642:Trp63	UTSW	16	25863758	missense	probably benign	0.35
Z1088:Trp63	UTSW	16	25763313	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGGGCACATTCATAGTTCTAGACC -3'
(R):5'- CAGCAAATTTTGGCTCCTCTAC -3'

Sequencing Primer
(F):5'- AGTTCTAGACCATGTTTCAATGC -3'
(R):5'- CCTACTATAGTATGGAGTCCTTAGC -3'

Posted On

2016-06-06