Incidental Mutation 'R5058:Meltf'
ID 391056
Institutional Source Beutler Lab
Gene Symbol Meltf
Ensembl Gene ENSMUSG00000022780
Gene Name melanotransferrin
Synonyms MTf, CD228, melanotransferrin, Mfi2
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5058 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 31878810-31899020 bp(+) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) A to G at 31887603 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023464] [ENSMUST00000023464]
AlphaFold Q9R0R1
Predicted Effect probably null
Transcript: ENSMUST00000023464
SMART Domains Protein: ENSMUSP00000023464
Gene: ENSMUSG00000022780

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 23 364 2.62e-183 SMART
TR_FER 366 719 4.23e-178 SMART
low complexity region 721 734 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000023464
SMART Domains Protein: ENSMUSP00000023464
Gene: ENSMUSG00000022780

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 23 364 2.62e-183 SMART
TR_FER 366 719 4.23e-178 SMART
low complexity region 721 734 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, exhibit no physical defects, and develop normally with no detectable alterations in iron metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Meltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Meltf APN 16 31888985 missense probably damaging 1.00
IGL02942:Meltf APN 16 31890778 nonsense probably null
IGL03340:Meltf APN 16 31892784 missense probably damaging 1.00
R0734:Meltf UTSW 16 31881958 missense probably damaging 0.99
R1023:Meltf UTSW 16 31884960 missense probably damaging 1.00
R1751:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1767:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1851:Meltf UTSW 16 31896577 missense probably benign 0.00
R1900:Meltf UTSW 16 31881969 critical splice donor site probably null
R1993:Meltf UTSW 16 31892622 nonsense probably null
R3423:Meltf UTSW 16 31896525 nonsense probably null
R3425:Meltf UTSW 16 31896525 nonsense probably null
R3804:Meltf UTSW 16 31884998 missense probably benign 0.23
R4724:Meltf UTSW 16 31892505 missense probably benign 0.03
R4976:Meltf UTSW 16 31894714 missense probably benign 0.01
R5007:Meltf UTSW 16 31887562 missense possibly damaging 0.60
R5534:Meltf UTSW 16 31890814 critical splice donor site probably null
R5661:Meltf UTSW 16 31881926 missense possibly damaging 0.65
R6028:Meltf UTSW 16 31887476 missense possibly damaging 0.91
R6424:Meltf UTSW 16 31880262 nonsense probably null
R6464:Meltf UTSW 16 31890776 missense probably benign 0.19
R6479:Meltf UTSW 16 31881882 missense probably damaging 1.00
R6525:Meltf UTSW 16 31888899 nonsense probably null
R6629:Meltf UTSW 16 31885076 missense probably damaging 1.00
R6964:Meltf UTSW 16 31880162 missense probably benign 0.41
R7133:Meltf UTSW 16 31892799 missense probably damaging 1.00
R7169:Meltf UTSW 16 31880162 missense probably benign 0.41
R7198:Meltf UTSW 16 31883799 missense possibly damaging 0.61
R7212:Meltf UTSW 16 31890814 critical splice donor site probably null
R7246:Meltf UTSW 16 31894862 missense probably damaging 1.00
R7407:Meltf UTSW 16 31894735 missense probably damaging 1.00
R7424:Meltf UTSW 16 31884946 missense probably damaging 1.00
R7475:Meltf UTSW 16 31881938 missense probably benign 0.12
R7727:Meltf UTSW 16 31883794 missense probably damaging 0.99
R7764:Meltf UTSW 16 31880267 missense probably benign 0.01
R8840:Meltf UTSW 16 31897202 missense probably damaging 0.98
R8896:Meltf UTSW 16 31890704 splice site probably benign
R9214:Meltf UTSW 16 31878945 missense probably benign
X0062:Meltf UTSW 16 31880200 missense probably damaging 1.00
Z1177:Meltf UTSW 16 31880234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTCCCTGATGTCAGAGG -3'
(R):5'- AGCCAACGATCTTATGCGC -3'

Sequencing Primer
(F):5'- GTCAGAGGACTTCCAGCTACTATG -3'
(R):5'- TGTAGGAAGGGCTGCGACC -3'
Posted On 2016-06-06