Incidental Mutation 'R5058:Col17a1'
ID391066
Institutional Source Beutler Lab
Gene Symbol Col17a1
Ensembl Gene ENSMUSG00000025064
Gene Namecollagen, type XVII, alpha 1
SynonymsBP180, Bpag2, BPAg2, Bpag
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5058 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47646344-47692094 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 47685550 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 13 (E13*)
Ref Sequence ENSEMBL: ENSMUSP00000084141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026045] [ENSMUST00000086923]
Predicted Effect probably null
Transcript: ENSMUST00000026045
AA Change: E13*
SMART Domains Protein: ENSMUSP00000026045
Gene: ENSMUSG00000025064
AA Change: E13*

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.2e-10 PFAM
low complexity region 634 651 N/A INTRINSIC
low complexity region 657 693 N/A INTRINSIC
internal_repeat_4 695 714 1.12e-5 PROSPERO
internal_repeat_3 695 723 3.81e-6 PROSPERO
internal_repeat_1 709 735 1.93e-9 PROSPERO
internal_repeat_4 719 738 1.12e-5 PROSPERO
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1201 1217 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1337 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Pfam:Collagen 1408 1462 3.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086923
AA Change: E13*
SMART Domains Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064
AA Change: E13*

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.1e-10 PFAM
Pfam:Collagen 647 726 5.2e-7 PFAM
Pfam:Collagen 699 772 1.8e-9 PFAM
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1164 1180 N/A INTRINSIC
low complexity region 1215 1229 N/A INTRINSIC
low complexity region 1238 1300 N/A INTRINSIC
low complexity region 1338 1348 N/A INTRINSIC
Pfam:Collagen 1371 1425 3.5e-9 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Col17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Col17a1 APN 19 47681403 missense probably damaging 1.00
IGL01620:Col17a1 APN 19 47668539 missense possibly damaging 0.81
IGL02149:Col17a1 APN 19 47668632 missense probably benign 0.01
IGL02176:Col17a1 APN 19 47651219 missense probably benign 0.02
IGL03352:Col17a1 APN 19 47681375 splice site probably null
IGL03409:Col17a1 APN 19 47666540 missense possibly damaging 0.79
scabby UTSW 19 47680408 nonsense probably null
IGL03050:Col17a1 UTSW 19 47648098 critical splice donor site probably null
PIT4480001:Col17a1 UTSW 19 47671374 missense probably benign 0.05
R0309:Col17a1 UTSW 19 47671362 splice site probably benign
R0316:Col17a1 UTSW 19 47685533 critical splice donor site probably null
R0330:Col17a1 UTSW 19 47670432 missense probably benign 0.27
R0391:Col17a1 UTSW 19 47663824 missense probably damaging 0.99
R0570:Col17a1 UTSW 19 47665878 missense possibly damaging 0.93
R0737:Col17a1 UTSW 19 47669433 missense possibly damaging 0.95
R1344:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1418:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1549:Col17a1 UTSW 19 47648910 unclassified probably benign
R1585:Col17a1 UTSW 19 47650837 missense probably benign 0.00
R1710:Col17a1 UTSW 19 47670931 missense probably damaging 1.00
R1712:Col17a1 UTSW 19 47649003 unclassified probably benign
R1800:Col17a1 UTSW 19 47650862 missense possibly damaging 0.72
R2007:Col17a1 UTSW 19 47667702 missense probably damaging 1.00
R2024:Col17a1 UTSW 19 47650746 missense probably benign 0.02
R2258:Col17a1 UTSW 19 47681377 critical splice donor site probably null
R2268:Col17a1 UTSW 19 47650111 missense probably benign 0.00
R3608:Col17a1 UTSW 19 47680405 missense probably benign 0.00
R4380:Col17a1 UTSW 19 47657090 missense possibly damaging 0.94
R4675:Col17a1 UTSW 19 47663058 critical splice acceptor site probably null
R4928:Col17a1 UTSW 19 47670458 splice site probably null
R5407:Col17a1 UTSW 19 47666507 missense probably damaging 1.00
R5417:Col17a1 UTSW 19 47662390 missense probably damaging 1.00
R5572:Col17a1 UTSW 19 47650729 missense probably benign 0.44
R5889:Col17a1 UTSW 19 47649072 missense possibly damaging 0.93
R5988:Col17a1 UTSW 19 47654220 missense probably damaging 1.00
R6054:Col17a1 UTSW 19 47680420 missense probably damaging 1.00
R6345:Col17a1 UTSW 19 47653379 missense possibly damaging 0.93
R6432:Col17a1 UTSW 19 47680408 nonsense probably null
R6484:Col17a1 UTSW 19 47670429 missense possibly damaging 0.67
R6754:Col17a1 UTSW 19 47650721 splice site probably null
R7028:Col17a1 UTSW 19 47652183 missense probably damaging 0.96
R7465:Col17a1 UTSW 19 47668105 nonsense probably null
R7565:Col17a1 UTSW 19 47671524 missense possibly damaging 0.77
R7662:Col17a1 UTSW 19 47681501 missense probably benign 0.04
R7726:Col17a1 UTSW 19 47655190 critical splice donor site probably null
Z1088:Col17a1 UTSW 19 47652178 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGAACCCATTTGATTATAAGGGCG -3'
(R):5'- TGCAATCAATGGGCAGAGTG -3'

Sequencing Primer
(F):5'- CCCATTTGATTATAAGGGCGTGGAAG -3'
(R):5'- CTGGTGTCTGTACAAGATTATATGC -3'
Posted On2016-06-06