Mutagenetix > Incidental Mutation

Incidental Mutation 'R5058:Col17a1'

391066

Institutional Source

Beutler Lab

Gene Symbol

Col17a1

Ensembl Gene

ENSMUSG00000025064

Gene Name

collagen, type XVII, alpha 1

Synonyms

BP180, Bpag2, BPAg2, Bpag

MMRRC Submission

042648-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5058 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47646344-47692094 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 47685550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 13 (E13*)

Ref Sequence

ENSEMBL: ENSMUSP00000084141 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026045] [ENSMUST00000086923]

AlphaFold

Q07563

Predicted Effect

probably null
Transcript: ENSMUST00000026045
AA Change: E13*

SMART Domains

Protein: ENSMUSP00000026045
Gene: ENSMUSG00000025064
AA Change: E13*

Domain	Start	End	E-Value	Type
low complexity region	12	28	N/A	INTRINSIC
low complexity region	60	74	N/A	INTRINSIC
low complexity region	317	335	N/A	INTRINSIC
low complexity region	431	461	N/A	INTRINSIC
transmembrane domain	476	498	N/A	INTRINSIC
Pfam:Collagen	570	631	3.2e-10	PFAM
low complexity region	634	651	N/A	INTRINSIC
low complexity region	657	693	N/A	INTRINSIC
internal_repeat_4	695	714	1.12e-5	PROSPERO
internal_repeat_3	695	723	3.81e-6	PROSPERO
internal_repeat_1	709	735	1.93e-9	PROSPERO
internal_repeat_4	719	738	1.12e-5	PROSPERO
Pfam:Collagen	753	816	1.3e-10	PFAM
Pfam:Collagen	825	871	5.9e-9	PFAM
low complexity region	889	927	N/A	INTRINSIC
low complexity region	939	960	N/A	INTRINSIC
low complexity region	981	999	N/A	INTRINSIC
low complexity region	1024	1034	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1091	1113	N/A	INTRINSIC
low complexity region	1126	1147	N/A	INTRINSIC
low complexity region	1165	1177	N/A	INTRINSIC
low complexity region	1201	1217	N/A	INTRINSIC
low complexity region	1252	1266	N/A	INTRINSIC
low complexity region	1275	1337	N/A	INTRINSIC
low complexity region	1375	1385	N/A	INTRINSIC
Pfam:Collagen	1408	1462	3.5e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000086923
AA Change: E13*

SMART Domains

Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064
AA Change: E13*

Domain	Start	End	E-Value	Type
low complexity region	12	28	N/A	INTRINSIC
low complexity region	60	74	N/A	INTRINSIC
low complexity region	317	335	N/A	INTRINSIC
low complexity region	431	461	N/A	INTRINSIC
transmembrane domain	476	498	N/A	INTRINSIC
Pfam:Collagen	570	631	3.1e-10	PFAM
Pfam:Collagen	647	726	5.2e-7	PFAM
Pfam:Collagen	699	772	1.8e-9	PFAM
Pfam:Collagen	753	816	1.3e-10	PFAM
Pfam:Collagen	825	871	5.9e-9	PFAM
low complexity region	889	927	N/A	INTRINSIC
low complexity region	939	960	N/A	INTRINSIC
low complexity region	981	999	N/A	INTRINSIC
low complexity region	1024	1034	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1091	1113	N/A	INTRINSIC
low complexity region	1126	1147	N/A	INTRINSIC
low complexity region	1164	1180	N/A	INTRINSIC
low complexity region	1215	1229	N/A	INTRINSIC
low complexity region	1238	1300	N/A	INTRINSIC
low complexity region	1338	1348	N/A	INTRINSIC
Pfam:Collagen	1371	1425	3.5e-9	PFAM

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.2%

Validation Efficiency

100% (79/79)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl1	T	C	8: 13,242,625	Y222C	probably damaging	Het
Adprhl2	A	G	4: 126,318,445	S94P	probably damaging	Het
Atp11b	A	G	3: 35,809,361	E202G	probably benign	Het
Cacna1d	G	T	14: 30,114,244	S849*	probably null	Het
Camsap1	T	C	2: 25,939,363	D783G	probably benign	Het
Cbfa2t2	T	A	2: 154,504,745	I124N	probably damaging	Het
Ccdc13	A	T	9: 121,817,547		probably benign	Het
Cfap44	G	A	16: 44,420,204		probably null	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dennd6b	A	G	15: 89,187,350	L288P	possibly damaging	Het
Dhx37	A	C	5: 125,422,231	Y638D	probably benign	Het
Epb41	G	A	4: 132,007,435		probably benign	Het
Esp31	A	T	17: 38,644,609	I48L	possibly damaging	Het
Fat3	T	C	9: 15,996,858	Q2616R	probably damaging	Het
Fbxo33	A	G	12: 59,219,133	I116T	probably benign	Het
Flnb	G	T	14: 7,924,262	E1792*	probably null	Het
Fzd2	G	A	11: 102,604,807	G26R	probably damaging	Het
Gm11677	T	A	11: 111,725,438		noncoding transcript	Het
Gm7137	A	T	10: 77,788,071		probably benign	Het
Hnrnpr	A	G	4: 136,336,337	T252A	possibly damaging	Het
Hyal5	T	C	6: 24,891,485	F433L	probably damaging	Het
Kcnmb4	T	A	10: 116,463,928		probably benign	Het
Meltf	A	G	16: 31,887,603		probably null	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Muc6	T	C	7: 141,644,224	D1213G	probably benign	Het
Ncam1	A	C	9: 49,798,695	F12C	probably benign	Het
Nfxl1	A	T	5: 72,556,239	D120E	probably benign	Het
Nrg1	T	C	8: 31,824,559	Q142R	probably damaging	Het
Olfr132	G	A	17: 38,130,541	S217F	probably damaging	Het
Olfr180	T	C	16: 58,916,072	T190A	probably benign	Het
Olfr250	C	A	9: 38,367,924	T116K	probably damaging	Het
Olfr347	T	G	2: 36,734,999	L226R	possibly damaging	Het
Olfr466	C	A	13: 65,152,929	A235D	possibly damaging	Het
Olfr684	T	C	7: 105,157,148	N178S	probably damaging	Het
Olfr948	C	A	9: 39,318,664	V317L	probably benign	Het
Olfr95	A	G	17: 37,211,667	L62P	probably damaging	Het
Padi2	G	T	4: 140,932,121	V246L	probably benign	Het
Pgghg	C	T	7: 140,942,542	T63I	possibly damaging	Het
Pitpnm1	A	G	19: 4,112,758	N1117S	probably benign	Het
Plch1	G	T	3: 63,722,781	T534K	probably damaging	Het
Poc1a	G	T	9: 106,349,813		probably benign	Het
Polr3c	T	C	3: 96,723,517	I196V	probably benign	Het
Prph	A	T	15: 99,055,232		probably benign	Het
Ptprg	C	A	14: 12,037,387	T189K	possibly damaging	Het
R3hcc1	A	T	14: 69,704,014	I183N	probably damaging	Het
Rundc1	T	C	11: 101,425,537	L145P	probably benign	Het
Slc26a3	A	G	12: 31,470,965	K723E	possibly damaging	Het
Slc38a3	T	C	9: 107,659,191	E2G	possibly damaging	Het
Slc9a5	G	T	8: 105,355,858	V252L	probably benign	Het
Smim26	C	T	2: 144,595,123	T64M	probably benign	Het
Socs4	C	T	14: 47,290,132	R175*	probably null	Het
Srebf2	T	C	15: 82,182,050	S600P	probably damaging	Het
Tas2r107	A	T	6: 131,659,742	S115T	probably damaging	Het
Tenm2	T	C	11: 36,207,080	D447G	possibly damaging	Het
Thbs2	T	A	17: 14,676,329	D766V	probably damaging	Het
Tinagl1	A	G	4: 130,167,457	V300A	probably benign	Het
Tle6	T	A	10: 81,594,238	N332I	possibly damaging	Het
Tle6	C	A	10: 81,595,957	W151L	probably damaging	Het
Tnfrsf13c	C	T	15: 82,224,207	V36M	probably damaging	Het
Tns2	T	C	15: 102,107,860	I211T	possibly damaging	Het
Trp63	A	G	16: 25,882,594	N379D	probably damaging	Het
Trpc2	T	C	7: 102,089,109	W433R	probably damaging	Het
Tyw1	T	A	5: 130,277,086	L350Q	probably benign	Het
Usf3	T	C	16: 44,212,707	L76P	probably damaging	Het
Vmn2r79	T	C	7: 87,002,215	L274P	probably damaging	Het

Other mutations in Col17a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Col17a1	APN	19	47681403	missense	probably damaging	1.00
IGL01620:Col17a1	APN	19	47668539	missense	possibly damaging	0.81
IGL02149:Col17a1	APN	19	47668632	missense	probably benign	0.01
IGL02176:Col17a1	APN	19	47651219	missense	probably benign	0.02
IGL03352:Col17a1	APN	19	47681375	splice site	probably null
IGL03409:Col17a1	APN	19	47666540	missense	possibly damaging	0.79
fleabitten	UTSW	19	47668105	nonsense	probably null
idaho	UTSW	19	47679422	nonsense	probably null
scabby	UTSW	19	47680408	nonsense	probably null
testimony	UTSW	19	47655190	critical splice donor site	probably null
IGL03050:Col17a1	UTSW	19	47648098	critical splice donor site	probably null
PIT4480001:Col17a1	UTSW	19	47671374	missense	probably benign	0.05
R0309:Col17a1	UTSW	19	47671362	splice site	probably benign
R0316:Col17a1	UTSW	19	47685533	critical splice donor site	probably null
R0330:Col17a1	UTSW	19	47670432	missense	probably benign	0.27
R0391:Col17a1	UTSW	19	47663824	missense	probably damaging	0.99
R0570:Col17a1	UTSW	19	47665878	missense	possibly damaging	0.93
R0737:Col17a1	UTSW	19	47669433	missense	possibly damaging	0.95
R1344:Col17a1	UTSW	19	47671505	missense	probably damaging	1.00
R1418:Col17a1	UTSW	19	47671505	missense	probably damaging	1.00
R1549:Col17a1	UTSW	19	47648910	unclassified	probably benign
R1585:Col17a1	UTSW	19	47650837	missense	probably benign	0.00
R1710:Col17a1	UTSW	19	47670931	missense	probably damaging	1.00
R1712:Col17a1	UTSW	19	47649003	unclassified	probably benign
R1800:Col17a1	UTSW	19	47650862	missense	possibly damaging	0.72
R2007:Col17a1	UTSW	19	47667702	missense	probably damaging	1.00
R2024:Col17a1	UTSW	19	47650746	missense	probably benign	0.02
R2258:Col17a1	UTSW	19	47681377	critical splice donor site	probably null
R2268:Col17a1	UTSW	19	47650111	missense	probably benign	0.00
R3608:Col17a1	UTSW	19	47680405	missense	probably benign	0.00
R4380:Col17a1	UTSW	19	47657090	missense	possibly damaging	0.94
R4675:Col17a1	UTSW	19	47663058	critical splice acceptor site	probably null
R4928:Col17a1	UTSW	19	47670458	splice site	probably null
R5407:Col17a1	UTSW	19	47666507	missense	probably damaging	1.00
R5417:Col17a1	UTSW	19	47662390	missense	probably damaging	1.00
R5572:Col17a1	UTSW	19	47650729	missense	probably benign	0.44
R5889:Col17a1	UTSW	19	47649072	missense	possibly damaging	0.93
R5988:Col17a1	UTSW	19	47654220	missense	probably damaging	1.00
R6054:Col17a1	UTSW	19	47680420	missense	probably damaging	1.00
R6345:Col17a1	UTSW	19	47653379	missense	possibly damaging	0.93
R6432:Col17a1	UTSW	19	47680408	nonsense	probably null
R6484:Col17a1	UTSW	19	47670429	missense	possibly damaging	0.67
R6754:Col17a1	UTSW	19	47650721	splice site	probably null
R7028:Col17a1	UTSW	19	47652183	missense	probably damaging	0.96
R7465:Col17a1	UTSW	19	47668105	nonsense	probably null
R7565:Col17a1	UTSW	19	47671524	missense	possibly damaging	0.77
R7662:Col17a1	UTSW	19	47681501	missense	probably benign	0.04
R7726:Col17a1	UTSW	19	47655190	critical splice donor site	probably null
R7957:Col17a1	UTSW	19	47661117	missense	probably damaging	1.00
R8677:Col17a1	UTSW	19	47651801	missense	probably benign	0.14
R8720:Col17a1	UTSW	19	47649092	critical splice acceptor site	probably benign
R8877:Col17a1	UTSW	19	47648758	missense	unknown
R9017:Col17a1	UTSW	19	47669459	missense	probably benign	0.00
R9057:Col17a1	UTSW	19	47649083	missense	probably damaging	0.96
R9231:Col17a1	UTSW	19	47679422	nonsense	probably null
R9714:Col17a1	UTSW	19	47648195	missense	unknown
Z1088:Col17a1	UTSW	19	47652178	missense	possibly damaging	0.85
Z1176:Col17a1	UTSW	19	47649429	small deletion	probably benign
Z1177:Col17a1	UTSW	19	47650304	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- AGAACCCATTTGATTATAAGGGCG -3'
(R):5'- TGCAATCAATGGGCAGAGTG -3'

Sequencing Primer
(F):5'- CCCATTTGATTATAAGGGCGTGGAAG -3'
(R):5'- CTGGTGTCTGTACAAGATTATATGC -3'

Posted On

2016-06-06