Mutagenetix > Incidental Mutation

Incidental Mutation 'R5023:Sis'

391089

Institutional Source

Beutler Lab

Gene Symbol

Sis

Ensembl Gene

ENSMUSG00000027790

Gene Name

sucrase isomaltase (alpha-glucosidase)

Synonyms

Si-s, sucrase-isomaltase

MMRRC Submission

042614-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5023 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72888557-72967863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72934122 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 787 (I787V)

Ref Sequence

ENSEMBL: ENSMUSP00000129116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]

AlphaFold

F8VQM5

Predicted Effect

probably benign
Transcript: ENSMUST00000094190
AA Change: I787V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: I787V

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167334
AA Change: I787V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: I787V

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Meta Mutation Damage Score

0.0776

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (127/129)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 124 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	A	T	11: 72,166,755	H739Q	probably benign	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abca8b	A	G	11: 109,974,988		probably null	Het
Adam1b	C	T	5: 121,501,159	V608M	probably damaging	Het
Ank2	A	G	3: 126,941,871		probably benign	Het
Ankrd17	A	C	5: 90,282,868	L1019R	probably damaging	Het
Arih1	T	C	9: 59,486,232	N39S	unknown	Het
Best3	G	A	10: 116,988,742	V38I	probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Cage1	G	T	13: 38,011,411	S778*	probably null	Het
Capn7	T	A	14: 31,352,426	V262E	probably damaging	Het
Ccdc190	A	G	1: 169,933,087	R95G	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Cdh18	G	A	15: 23,259,666	S194N	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Ctsw	T	A	19: 5,466,049	D237V	probably damaging	Het
Cyp2c68	G	A	19: 39,712,507	T289I	probably benign	Het
Cyp4f39	A	G	17: 32,481,104	Y133C	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dnah7a	C	A	1: 53,647,248	E248*	probably null	Het
Eef2kmt	T	A	16: 5,247,599	D248V	probably damaging	Het
Ewsr1	T	C	11: 5,088,054	T113A	possibly damaging	Het
Fbxo4	A	G	15: 3,977,756		probably null	Het
Fbxo43	A	T	15: 36,162,929	M44K	probably benign	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fgf5	C	A	5: 98,262,015	A141E	probably damaging	Het
Gfm1	T	C	3: 67,473,544	V664A	probably damaging	Het
Glp2r	T	C	11: 67,741,032	T121A	possibly damaging	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5155	A	T	7: 17,902,706	D236V	probably damaging	Het
Gm7030	A	G	17: 36,109,415		probably benign	Het
Gnb2	G	A	5: 137,529,940		probably null	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpx5	C	T	13: 21,288,745	V140I	probably damaging	Het
Gtpbp1	A	T	15: 79,719,221	Q637L	possibly damaging	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hhat	A	T	1: 192,727,339	L138Q	probably damaging	Het
Hipk1	G	T	3: 103,777,507	T264N	probably damaging	Het
Hjurp	A	T	1: 88,275,050	Y71N	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Hook3	TAGAG	TAG	8: 26,032,019		probably null	Het
Ifi204	G	A	1: 173,751,740	T513I	possibly damaging	Het
Ino80b	G	T	6: 83,125,042	S26R	probably damaging	Het
Ints9	T	A	14: 64,980,228	L68H	probably damaging	Het
Isx	C	T	8: 74,892,714	T178I	probably benign	Het
Kel	A	G	6: 41,688,111	L255P	probably damaging	Het
Klf11	T	A	12: 24,655,359	S271T	probably benign	Het
Klhl20	A	C	1: 161,109,220		probably null	Het
Lama2	G	A	10: 27,190,504	T1127I	probably damaging	Het
Larp1b	T	A	3: 41,033,985	N81K	possibly damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Map3k20	T	A	2: 72,402,345		probably benign	Het
Mbd6	C	T	10: 127,286,441	V173I	probably benign	Het
Milr1	A	G	11: 106,766,965	D131G	possibly damaging	Het
Mybpc1	T	G	10: 88,543,774	D635A	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Ndufa7	A	G	17: 33,824,603		probably benign	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Neo1	T	C	9: 58,990,271	D134G	probably damaging	Het
Nme4	G	A	17: 26,093,668	T129I	probably benign	Het
Npffr2	A	T	5: 89,582,687	T159S	probably benign	Het
Nup153	A	T	13: 46,681,109		probably benign	Het
Olfr139	T	A	11: 74,045,055	D73V	probably damaging	Het
Olfr616	A	C	7: 103,565,171	M36R	possibly damaging	Het
Pate2	T	C	9: 35,686,111		probably benign	Het
Pcca	A	G	14: 122,790,398	N73D	probably damaging	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Pkhd1l1	A	T	15: 44,528,191	H1551L	probably benign	Het
Pkhd1l1	G	A	15: 44,582,227	M3768I	probably benign	Het
Ppa2	A	G	3: 133,370,434	M275V	probably benign	Het
Ptpn23	G	A	9: 110,388,556	T744I	probably benign	Het
Ptprv	A	T	1: 135,124,506		noncoding transcript	Het
Rad17	A	T	13: 100,645,063	H75Q	possibly damaging	Het
Rbm44	T	C	1: 91,169,098		probably null	Het
Rbpj	C	T	5: 53,649,415	R201W	probably damaging	Het
Rbpjl	C	A	2: 164,410,289	L215I	probably damaging	Het
Ror1	A	G	4: 100,425,932	E398G	probably benign	Het
Scamp3	T	A	3: 89,182,293		probably benign	Het
Selenot	CATGTATG	CATGTATGTATG	3: 58,588,453		probably null	Het
Siglec15	A	G	18: 78,048,675	C104R	probably damaging	Het
Slc17a8	T	C	10: 89,576,560	D521G	probably benign	Het
Slc7a10	T	A	7: 35,197,355	M172K	possibly damaging	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Slitrk3	T	C	3: 73,050,648	T264A	probably benign	Het
Smg8	A	C	11: 87,086,137	V206G	probably damaging	Het
Smg9	A	G	7: 24,405,872	K137R	possibly damaging	Het
Srrm2	C	A	17: 23,819,317		probably benign	Het
Sult2a2	T	A	7: 13,734,860	Y84N	possibly damaging	Het
Syngr2	A	T	11: 117,812,510	I34F	probably benign	Het
Tank	G	A	2: 61,578,635		probably benign	Het
Tead4	T	C	6: 128,294,171		probably benign	Het
Tex36	A	T	7: 133,595,290	C33S	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tmem240	T	A	4: 155,739,674	L92Q	probably damaging	Het
Tmem268	C	G	4: 63,568,540	S100C	probably damaging	Het
Tmod3	G	A	9: 75,511,206	P183S	probably damaging	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trim16	A	T	11: 62,836,812	Y233F	probably benign	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ttc3	A	G	16: 94,429,359	E450G	probably benign	Het
Ttk	A	G	9: 83,863,541	D647G	probably damaging	Het
Ubash3b	A	G	9: 41,037,459	C187R	possibly damaging	Het
Vmn1r29	T	A	6: 58,308,067	Y257*	probably null	Het
Vmn1r33	T	C	6: 66,612,105	N155S	probably benign	Het
Vmn2r28	T	A	7: 5,486,464	I459L	probably benign	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Vwde	T	C	6: 13,192,642	I421V	possibly damaging	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zbtb11	A	G	16: 56,006,065	Y819C	probably damaging	Het
Zfp112	A	G	7: 24,126,484	T624A	probably damaging	Het
Zfp592	A	G	7: 81,024,347	D353G	probably damaging	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Zfp677	A	T	17: 21,397,794	H371L	probably damaging	Het
Zfp780b	T	C	7: 27,963,448	K561E	possibly damaging	Het
Zfp936	G	A	7: 43,187,257	D31N	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het
Zpbp	C	T	11: 11,415,248	E200K	probably benign	Het

Other mutations in Sis

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Sis	APN	3	72946636	missense	probably benign
IGL00715:Sis	APN	3	72934124	missense	probably damaging	1.00
IGL00721:Sis	APN	3	72943579	missense	probably damaging	1.00
IGL00766:Sis	APN	3	72907237	splice site	probably benign
IGL00783:Sis	APN	3	72946632	missense	probably benign
IGL00805:Sis	APN	3	72934199	missense	probably benign	0.05
IGL00932:Sis	APN	3	72940956	splice site	probably benign
IGL01020:Sis	APN	3	72966838	missense	probably damaging	1.00
IGL01024:Sis	APN	3	72911876	missense	probably damaging	1.00
IGL01286:Sis	APN	3	72941025	missense	probably damaging	1.00
IGL01457:Sis	APN	3	72961021	missense	probably benign
IGL01514:Sis	APN	3	72935920	splice site	probably benign
IGL01986:Sis	APN	3	72945212	missense	probably damaging	1.00
IGL02110:Sis	APN	3	72928699	nonsense	probably null
IGL02132:Sis	APN	3	72947471	missense	probably benign	0.00
IGL02152:Sis	APN	3	72888986	utr 3 prime	probably benign
IGL02200:Sis	APN	3	72943604	missense	probably damaging	0.99
IGL02244:Sis	APN	3	72956190	missense	probably benign	0.19
IGL02307:Sis	APN	3	72911834	splice site	probably benign
IGL02374:Sis	APN	3	72925456	missense	probably benign	0.03
IGL02437:Sis	APN	3	72919614	critical splice acceptor site	probably null
IGL02571:Sis	APN	3	72956304	splice site	probably benign
IGL02601:Sis	APN	3	72913210	missense	probably benign	0.44
IGL03063:Sis	APN	3	72928297	missense	probably benign
IGL03382:Sis	APN	3	72928719	missense	probably benign	0.00
IGL03397:Sis	APN	3	72935879	missense	probably benign	0.44
PIT1430001:Sis	UTSW	3	72922829	missense	probably damaging	0.97
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0046:Sis	UTSW	3	72932094	missense	probably benign	0.01
R0094:Sis	UTSW	3	72921437	missense	probably damaging	1.00
R0096:Sis	UTSW	3	72928267	missense	probably damaging	1.00
R0505:Sis	UTSW	3	72960296	missense	probably benign	0.29
R0544:Sis	UTSW	3	72951642	missense	probably damaging	1.00
R0551:Sis	UTSW	3	72925407	missense	possibly damaging	0.79
R0617:Sis	UTSW	3	72965605	missense	probably damaging	1.00
R0698:Sis	UTSW	3	72910498	missense	probably damaging	1.00
R0701:Sis	UTSW	3	72941045	missense	probably damaging	1.00
R0704:Sis	UTSW	3	72949822	missense	possibly damaging	0.63
R0706:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0710:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0752:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0753:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0754:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0767:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0769:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0772:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0774:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0776:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0818:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0819:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0885:Sis	UTSW	3	72911949	nonsense	probably null
R1076:Sis	UTSW	3	72934098	missense	probably damaging	0.97
R1140:Sis	UTSW	3	72951616	missense	probably damaging	0.98
R1175:Sis	UTSW	3	72958104	splice site	probably benign
R1301:Sis	UTSW	3	72946582	missense	possibly damaging	0.76
R1437:Sis	UTSW	3	72934142	missense	probably damaging	1.00
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1472:Sis	UTSW	3	72889027	missense	probably benign	0.12
R1584:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1707:Sis	UTSW	3	72909087	splice site	probably benign
R1715:Sis	UTSW	3	72889010	missense	possibly damaging	0.47
R1719:Sis	UTSW	3	72965604	missense	probably damaging	1.00
R1728:Sis	UTSW	3	72965645	nonsense	probably null
R1784:Sis	UTSW	3	72965645	nonsense	probably null
R1820:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R1972:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R1973:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R2054:Sis	UTSW	3	72913237	missense	probably benign	0.01
R2233:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2235:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2276:Sis	UTSW	3	72914601	nonsense	probably null
R2435:Sis	UTSW	3	72911904	missense	probably benign	0.01
R2885:Sis	UTSW	3	72909173	missense	probably benign	0.01
R2966:Sis	UTSW	3	72889010	missense	probably benign	0.30
R3708:Sis	UTSW	3	72943523	missense	probably benign	0.02
R3790:Sis	UTSW	3	72921414	missense	probably damaging	1.00
R3807:Sis	UTSW	3	72925596	missense	probably benign	0.01
R3858:Sis	UTSW	3	72928652	missense	probably damaging	0.99
R3974:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R3975:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R4037:Sis	UTSW	3	72928602	missense	probably benign
R4080:Sis	UTSW	3	72921184	missense	probably damaging	1.00
R4204:Sis	UTSW	3	72961082	missense	probably benign
R4394:Sis	UTSW	3	72956149	missense	probably damaging	1.00
R4470:Sis	UTSW	3	72928159	splice site	probably null
R4573:Sis	UTSW	3	72928237	missense	possibly damaging	0.94
R4868:Sis	UTSW	3	72943548	missense	probably benign	0.09
R5264:Sis	UTSW	3	72949756	missense	probably damaging	0.98
R5414:Sis	UTSW	3	72952493	missense	probably benign
R5462:Sis	UTSW	3	72949838	missense	probably damaging	0.96
R5523:Sis	UTSW	3	72891421	missense	probably benign	0.00
R5584:Sis	UTSW	3	72910415	missense	probably damaging	1.00
R5587:Sis	UTSW	3	72914576	missense	possibly damaging	0.94
R5725:Sis	UTSW	3	72965598	missense	probably damaging	1.00
R5769:Sis	UTSW	3	72928235	missense	probably damaging	0.98
R5790:Sis	UTSW	3	72928174	missense	probably benign
R5864:Sis	UTSW	3	72949818	missense	probably damaging	1.00
R5902:Sis	UTSW	3	72960256	critical splice donor site	probably null
R5925:Sis	UTSW	3	72921380	splice site	probably null
R6018:Sis	UTSW	3	72913192	missense	possibly damaging	0.95
R6029:Sis	UTSW	3	72928308	missense	probably benign	0.30
R6124:Sis	UTSW	3	72953211	missense	possibly damaging	0.69
R6171:Sis	UTSW	3	72961027	missense	possibly damaging	0.75
R6182:Sis	UTSW	3	72904293	missense	probably benign	0.05
R6295:Sis	UTSW	3	72966770	missense	probably damaging	0.99
R6416:Sis	UTSW	3	72911854	missense	probably damaging	1.00
R6431:Sis	UTSW	3	72958174	missense	probably benign	0.00
R6472:Sis	UTSW	3	72938734	nonsense	probably null
R6517:Sis	UTSW	3	72907142	missense	probably damaging	1.00
R6701:Sis	UTSW	3	72949527	missense	probably damaging	1.00
R6796:Sis	UTSW	3	72965618	missense	probably benign	0.06
R6853:Sis	UTSW	3	72891426	missense	possibly damaging	0.93
R6906:Sis	UTSW	3	72919485	missense	probably damaging	1.00
R7058:Sis	UTSW	3	72903607	missense	probably damaging	0.98
R7357:Sis	UTSW	3	72925071	missense	probably damaging	1.00
R7381:Sis	UTSW	3	72913292	splice site	probably null
R7439:Sis	UTSW	3	72909041	missense	possibly damaging	0.81
R7742:Sis	UTSW	3	72925098	missense	probably benign	0.19
R7813:Sis	UTSW	3	72925468	missense	probably benign	0.01
R7883:Sis	UTSW	3	72920996	missense	possibly damaging	0.78
R7899:Sis	UTSW	3	72937251	missense	probably damaging	1.00
R7915:Sis	UTSW	3	72921138	missense	probably damaging	0.99
R7985:Sis	UTSW	3	72936961	splice site	probably null
R8020:Sis	UTSW	3	72908965	critical splice donor site	probably null
R8023:Sis	UTSW	3	72952480	missense	probably damaging	0.97
R8029:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R8053:Sis	UTSW	3	72949568	nonsense	probably null
R8062:Sis	UTSW	3	72920988	nonsense	probably null
R8074:Sis	UTSW	3	72917198	missense	probably damaging	1.00
R8085:Sis	UTSW	3	72907129	missense	probably damaging	1.00
R8137:Sis	UTSW	3	72889045	missense	probably benign	0.22
R8349:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8354:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8366:Sis	UTSW	3	72958233	missense	probably damaging	1.00
R8449:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8454:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8474:Sis	UTSW	3	72929397	missense	probably damaging	1.00
R8515:Sis	UTSW	3	72929409	missense	probably benign	0.00
R8680:Sis	UTSW	3	72960295	missense	probably damaging	1.00
R8703:Sis	UTSW	3	72960324	missense	probably damaging	1.00
R9098:Sis	UTSW	3	72937245	missense	possibly damaging	0.66
R9466:Sis	UTSW	3	72965577	critical splice donor site	probably null
R9574:Sis	UTSW	3	72921157	missense	probably benign	0.05
R9630:Sis	UTSW	3	72921389	missense	probably benign	0.11
R9680:Sis	UTSW	3	72956288	missense	probably benign	0.12
R9709:Sis	UTSW	3	72891741	missense	possibly damaging	0.47
R9731:Sis	UTSW	3	72928210	missense	probably benign	0.01
X0009:Sis	UTSW	3	72889022	missense	probably damaging	0.99
X0024:Sis	UTSW	3	72928670	missense	probably benign
X0060:Sis	UTSW	3	72920906	intron	probably benign
Z1176:Sis	UTSW	3	72904273	missense	probably benign	0.05
Z1176:Sis	UTSW	3	72943557	missense	probably benign	0.25
Z1177:Sis	UTSW	3	72909172	missense	possibly damaging	0.88
Z1177:Sis	UTSW	3	72910474	missense	probably damaging	1.00
Z1177:Sis	UTSW	3	72943569	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCCAGCCACTGTTATTCTTAG -3'
(R):5'- GCCATGCTGCAGATGAATAC -3'

Sequencing Primer
(F):5'- AACTGTAAGTCCCCACATA -3'
(R):5'- GCCATGCTGCAGATGAATACTACAC -3'

Posted On

2016-06-06