Incidental Mutation 'R5023:Herc1'
ID 391131
Institutional Source Beutler Lab
Gene Symbol Herc1
Ensembl Gene ENSMUSG00000038664
Gene Name HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms tbl, D130015N03Rik, 2810449H11Rik
MMRRC Submission 042614-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5023 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 66257732-66416057 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66377608 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 3458 (K3458M)
Ref Sequence ENSEMBL: ENSMUSP00000044801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042824]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042824
AA Change: K3458M

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664
AA Change: K3458M

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:RCC1 476 526 5.4e-15 PFAM
Pfam:RCC1_2 513 542 1.3e-9 PFAM
Pfam:RCC1 529 576 5.5e-16 PFAM
Pfam:RCC1 579 629 1.5e-10 PFAM
Pfam:RCC1 632 680 3.6e-9 PFAM
Pfam:RCC1_2 667 696 2.2e-11 PFAM
Pfam:RCC1 683 733 1.2e-14 PFAM
low complexity region 787 807 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1080 1100 N/A INTRINSIC
low complexity region 1348 1378 N/A INTRINSIC
low complexity region 1659 1676 N/A INTRINSIC
low complexity region 1865 1874 N/A INTRINSIC
low complexity region 2002 2030 N/A INTRINSIC
SPRY 2067 2188 1.8e-30 SMART
coiled coil region 2251 2280 N/A INTRINSIC
low complexity region 2410 2423 N/A INTRINSIC
low complexity region 2613 2629 N/A INTRINSIC
low complexity region 2633 2648 N/A INTRINSIC
low complexity region 2650 2667 N/A INTRINSIC
low complexity region 2736 2749 N/A INTRINSIC
low complexity region 2882 2896 N/A INTRINSIC
low complexity region 2924 2935 N/A INTRINSIC
low complexity region 2971 2987 N/A INTRINSIC
low complexity region 3045 3051 N/A INTRINSIC
low complexity region 3168 3186 N/A INTRINSIC
low complexity region 3191 3213 N/A INTRINSIC
low complexity region 3364 3379 N/A INTRINSIC
WD40 3415 3454 1.68e-6 SMART
WD40 3570 3608 3.68e1 SMART
WD40 3613 3652 4.3e-1 SMART
WD40 3657 3702 3.17e-2 SMART
WD40 3734 3773 8.29e-6 SMART
low complexity region 3950 3964 N/A INTRINSIC
Pfam:RCC1_2 4079 4111 7.3e-9 PFAM
Pfam:RCC1 4098 4147 3.4e-16 PFAM
Pfam:RCC1_2 4134 4163 1.8e-7 PFAM
Pfam:RCC1 4150 4199 7.2e-16 PFAM
Pfam:RCC1 4204 4252 6.1e-12 PFAM
Pfam:RCC1 4255 4304 2.4e-7 PFAM
Pfam:RCC1_2 4291 4320 5.8e-12 PFAM
Pfam:RCC1 4307 4356 8.9e-16 PFAM
Blast:HECTc 4389 4423 2e-11 BLAST
HECTc 4497 4846 8.2e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124969
Meta Mutation Damage Score 0.0965 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (127/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,057,581 (GRCm39) H739Q probably benign Het
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Abca8b A G 11: 109,865,814 (GRCm39) probably null Het
Adam1b C T 5: 121,639,222 (GRCm39) V608M probably damaging Het
Ank2 A G 3: 126,735,520 (GRCm39) probably benign Het
Ankrd17 A C 5: 90,430,727 (GRCm39) L1019R probably damaging Het
Arih1 T C 9: 59,393,515 (GRCm39) N39S unknown Het
Best3 G A 10: 116,824,647 (GRCm39) V38I probably benign Het
Bicc1 A G 10: 70,783,713 (GRCm39) S393P possibly damaging Het
C1d T A 11: 17,216,674 (GRCm39) N135K probably benign Het
Cage1 G T 13: 38,195,387 (GRCm39) S778* probably null Het
Capn7 T A 14: 31,074,383 (GRCm39) V262E probably damaging Het
Ccdc190 A G 1: 169,760,656 (GRCm39) R95G probably damaging Het
Cd163 C T 6: 124,302,247 (GRCm39) T937I probably damaging Het
Cdh18 G A 15: 23,259,752 (GRCm39) S194N probably damaging Het
Ceacam23 A T 7: 17,636,631 (GRCm39) D236V probably damaging Het
Clec4b2 A T 6: 123,177,915 (GRCm39) S77C probably null Het
Ctsw T A 19: 5,516,077 (GRCm39) D237V probably damaging Het
Cyp2c68 G A 19: 39,700,951 (GRCm39) T289I probably benign Het
Cyp4f39 A G 17: 32,700,078 (GRCm39) Y133C probably damaging Het
Dlg5 T C 14: 24,186,690 (GRCm39) E1847G probably damaging Het
Dnah7a C A 1: 53,686,407 (GRCm39) E248* probably null Het
Eef2kmt T A 16: 5,065,463 (GRCm39) D248V probably damaging Het
Ewsr1 T C 11: 5,038,054 (GRCm39) T113A possibly damaging Het
Fbxo4 A G 15: 4,007,238 (GRCm39) probably null Het
Fbxo43 A T 15: 36,163,075 (GRCm39) M44K probably benign Het
Fchsd1 A G 18: 38,097,863 (GRCm39) I340T possibly damaging Het
Fgf5 C A 5: 98,409,874 (GRCm39) A141E probably damaging Het
Gfm1 T C 3: 67,380,877 (GRCm39) V664A probably damaging Het
Glp2r T C 11: 67,631,858 (GRCm39) T121A possibly damaging Het
Gm10803 A C 2: 93,394,517 (GRCm39) L96F probably damaging Het
Gm14569 T C X: 35,694,470 (GRCm39) D1413G probably benign Het
Gm15455 T C 1: 33,876,432 (GRCm39) noncoding transcript Het
Gm1818 G C 12: 48,602,318 (GRCm39) noncoding transcript Het
Gnb2 G A 5: 137,528,202 (GRCm39) probably null Het
Gpc4 G A X: 51,163,440 (GRCm39) R148C probably damaging Het
Gpx5 C T 13: 21,472,915 (GRCm39) V140I probably damaging Het
Gtpbp1 A T 15: 79,603,422 (GRCm39) Q637L possibly damaging Het
H2-T9 A G 17: 36,420,307 (GRCm39) probably benign Het
Hhat A T 1: 192,409,647 (GRCm39) L138Q probably damaging Het
Hipk1 G T 3: 103,684,823 (GRCm39) T264N probably damaging Het
Hjurp A T 1: 88,202,772 (GRCm39) Y71N possibly damaging Het
Hnf4g G T 3: 3,709,647 (GRCm39) A144S probably damaging Het
Hook3 TAGAG TAG 8: 26,522,047 (GRCm39) probably null Het
Ifi204 G A 1: 173,579,306 (GRCm39) T513I possibly damaging Het
Ino80b G T 6: 83,102,023 (GRCm39) S26R probably damaging Het
Ints9 T A 14: 65,217,677 (GRCm39) L68H probably damaging Het
Isx C T 8: 75,619,342 (GRCm39) T178I probably benign Het
Kel A G 6: 41,665,045 (GRCm39) L255P probably damaging Het
Klf11 T A 12: 24,705,358 (GRCm39) S271T probably benign Het
Klhl20 A C 1: 160,936,790 (GRCm39) probably null Het
Lama2 G A 10: 27,066,500 (GRCm39) T1127I probably damaging Het
Larp1b T A 3: 40,988,420 (GRCm39) N81K possibly damaging Het
Lsm11 T C 11: 45,835,666 (GRCm39) D25G probably damaging Het
Map3k20 T A 2: 72,232,689 (GRCm39) probably benign Het
Mbd6 C T 10: 127,122,310 (GRCm39) V173I probably benign Het
Milr1 A G 11: 106,657,791 (GRCm39) D131G possibly damaging Het
Mybpc1 T G 10: 88,379,636 (GRCm39) D635A probably damaging Het
Myh7b G C 2: 155,474,293 (GRCm39) R1669S possibly damaging Het
Ndufa7 A G 17: 34,043,577 (GRCm39) probably benign Het
Ndufs3 C A 2: 90,729,004 (GRCm39) A161S probably benign Het
Neo1 T C 9: 58,897,554 (GRCm39) D134G probably damaging Het
Nme4 G A 17: 26,312,642 (GRCm39) T129I probably benign Het
Npffr2 A T 5: 89,730,546 (GRCm39) T159S probably benign Het
Nup153 A T 13: 46,834,585 (GRCm39) probably benign Het
Or3a10 T A 11: 73,935,881 (GRCm39) D73V probably damaging Het
Or51ac3 A C 7: 103,214,378 (GRCm39) M36R possibly damaging Het
Pate2 T C 9: 35,597,407 (GRCm39) probably benign Het
Pcca A G 14: 123,027,810 (GRCm39) N73D probably damaging Het
Pip5k1c G A 10: 81,146,723 (GRCm39) probably null Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Pkhd1l1 G A 15: 44,445,623 (GRCm39) M3768I probably benign Het
Ppa2 A G 3: 133,076,195 (GRCm39) M275V probably benign Het
Ptpn23 G A 9: 110,217,624 (GRCm39) T744I probably benign Het
Ptprv A T 1: 135,052,244 (GRCm39) noncoding transcript Het
Rad17 A T 13: 100,781,571 (GRCm39) H75Q possibly damaging Het
Rbm44 T C 1: 91,096,820 (GRCm39) probably null Het
Rbpj C T 5: 53,806,757 (GRCm39) R201W probably damaging Het
Rbpjl C A 2: 164,252,209 (GRCm39) L215I probably damaging Het
Ror1 A G 4: 100,283,129 (GRCm39) E398G probably benign Het
Scamp3 T A 3: 89,089,600 (GRCm39) probably benign Het
Selenot CATGTATG CATGTATGTATG 3: 58,495,874 (GRCm39) probably null Het
Siglec15 A G 18: 78,091,890 (GRCm39) C104R probably damaging Het
Sis T C 3: 72,841,455 (GRCm39) I787V probably benign Het
Slc17a8 T C 10: 89,412,422 (GRCm39) D521G probably benign Het
Slc7a10 T A 7: 34,896,780 (GRCm39) M172K possibly damaging Het
Slco4c1 G A 1: 96,768,953 (GRCm39) P303L probably damaging Het
Slitrk3 T C 3: 72,957,981 (GRCm39) T264A probably benign Het
Smg8 A C 11: 86,976,963 (GRCm39) V206G probably damaging Het
Smg9 A G 7: 24,105,297 (GRCm39) K137R possibly damaging Het
Srrm2 C A 17: 24,038,291 (GRCm39) probably benign Het
Sult2a2 T A 7: 13,468,785 (GRCm39) Y84N possibly damaging Het
Syngr2 A T 11: 117,703,336 (GRCm39) I34F probably benign Het
Tank G A 2: 61,408,979 (GRCm39) probably benign Het
Tead4 T C 6: 128,271,134 (GRCm39) probably benign Het
Tesl1 G A X: 23,773,480 (GRCm39) G327E probably damaging Het
Tex36 A T 7: 133,197,019 (GRCm39) C33S probably benign Het
Timd5 T A 11: 46,419,359 (GRCm39) D58E probably damaging Het
Timm21 C A 18: 84,967,539 (GRCm39) V112L possibly damaging Het
Tmem240 T A 4: 155,824,131 (GRCm39) L92Q probably damaging Het
Tmem268 C G 4: 63,486,777 (GRCm39) S100C probably damaging Het
Tmod3 G A 9: 75,418,488 (GRCm39) P183S probably damaging Het
Trappc10 G T 10: 78,052,994 (GRCm39) F260L possibly damaging Het
Trim16 A T 11: 62,727,638 (GRCm39) Y233F probably benign Het
Trmt112 T C 19: 6,888,121 (GRCm39) V91A probably benign Het
Ttc3 A G 16: 94,230,218 (GRCm39) E450G probably benign Het
Ttk A G 9: 83,745,594 (GRCm39) D647G probably damaging Het
Ubash3b A G 9: 40,948,755 (GRCm39) C187R possibly damaging Het
Vmn1r29 T A 6: 58,285,052 (GRCm39) Y257* probably null Het
Vmn1r33 T C 6: 66,589,089 (GRCm39) N155S probably benign Het
Vmn2r28 T A 7: 5,489,463 (GRCm39) I459L probably benign Het
Vps16 A G 2: 130,281,372 (GRCm39) S235G probably benign Het
Vwde T C 6: 13,192,641 (GRCm39) I421V possibly damaging Het
Xiap T C X: 41,183,342 (GRCm39) F23L probably benign Het
Xkr7 A G 2: 152,896,300 (GRCm39) T385A probably benign Het
Zbtb11 A G 16: 55,826,428 (GRCm39) Y819C probably damaging Het
Zfp112 A G 7: 23,825,909 (GRCm39) T624A probably damaging Het
Zfp592 A G 7: 80,674,095 (GRCm39) D353G probably damaging Het
Zfp62 T A 11: 49,106,556 (GRCm39) S216T probably damaging Het
Zfp677 A T 17: 21,618,056 (GRCm39) H371L probably damaging Het
Zfp780b T C 7: 27,662,873 (GRCm39) K561E possibly damaging Het
Zfp936 G A 7: 42,836,681 (GRCm39) D31N probably damaging Het
Znfx1 T C 2: 166,881,746 (GRCm39) Y217C probably damaging Het
Zpbp C T 11: 11,365,248 (GRCm39) E200K probably benign Het
Other mutations in Herc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Herc1 APN 9 66,391,248 (GRCm39) missense probably benign 0.02
IGL00159:Herc1 APN 9 66,344,964 (GRCm39) missense possibly damaging 0.94
IGL00486:Herc1 APN 9 66,383,402 (GRCm39) missense probably benign
IGL00717:Herc1 APN 9 66,392,284 (GRCm39) missense probably damaging 1.00
IGL00766:Herc1 APN 9 66,358,023 (GRCm39) missense probably damaging 1.00
IGL00776:Herc1 APN 9 66,328,320 (GRCm39) missense probably benign
IGL00987:Herc1 APN 9 66,315,334 (GRCm39) missense probably benign 0.07
IGL01090:Herc1 APN 9 66,376,457 (GRCm39) nonsense probably null
IGL01098:Herc1 APN 9 66,369,204 (GRCm39) critical splice donor site probably null
IGL01106:Herc1 APN 9 66,383,720 (GRCm39) splice site probably benign
IGL01120:Herc1 APN 9 66,336,162 (GRCm39) missense probably benign
IGL01359:Herc1 APN 9 66,346,550 (GRCm39) missense probably benign 0.01
IGL01360:Herc1 APN 9 66,390,981 (GRCm39) missense probably benign
IGL01364:Herc1 APN 9 66,306,643 (GRCm39) missense probably benign 0.00
IGL01470:Herc1 APN 9 66,404,918 (GRCm39) missense possibly damaging 0.94
IGL01670:Herc1 APN 9 66,394,342 (GRCm39) missense probably damaging 1.00
IGL01825:Herc1 APN 9 66,307,089 (GRCm39) missense probably benign 0.00
IGL01903:Herc1 APN 9 66,294,154 (GRCm39) nonsense probably null
IGL01988:Herc1 APN 9 66,395,357 (GRCm39) splice site probably benign
IGL02074:Herc1 APN 9 66,358,265 (GRCm39) missense probably benign
IGL02089:Herc1 APN 9 66,388,151 (GRCm39) missense probably damaging 1.00
IGL02177:Herc1 APN 9 66,341,793 (GRCm39) missense probably benign
IGL02300:Herc1 APN 9 66,383,645 (GRCm39) missense probably benign 0.01
IGL02304:Herc1 APN 9 66,383,696 (GRCm39) missense probably benign 0.06
IGL02369:Herc1 APN 9 66,399,293 (GRCm39) nonsense probably null
IGL02445:Herc1 APN 9 66,340,764 (GRCm39) missense possibly damaging 0.95
IGL02447:Herc1 APN 9 66,404,610 (GRCm39) missense possibly damaging 0.59
IGL02549:Herc1 APN 9 66,307,183 (GRCm39) missense probably damaging 0.98
IGL02571:Herc1 APN 9 66,341,887 (GRCm39) splice site probably benign
IGL02709:Herc1 APN 9 66,404,962 (GRCm39) missense probably damaging 0.97
IGL02717:Herc1 APN 9 66,279,203 (GRCm39) nonsense probably null
IGL02726:Herc1 APN 9 66,349,270 (GRCm39) missense probably benign 0.37
IGL02733:Herc1 APN 9 66,358,274 (GRCm39) missense probably benign
IGL02963:Herc1 APN 9 66,296,105 (GRCm39) missense probably damaging 0.99
IGL03101:Herc1 APN 9 66,395,279 (GRCm39) missense probably benign
IGL03193:Herc1 APN 9 66,309,962 (GRCm39) missense probably benign
IGL03203:Herc1 APN 9 66,296,182 (GRCm39) critical splice donor site probably null
IGL03216:Herc1 APN 9 66,386,228 (GRCm39) missense probably benign 0.06
IGL03282:Herc1 APN 9 66,358,741 (GRCm39) missense probably benign 0.05
IGL03295:Herc1 APN 9 66,303,985 (GRCm39) missense possibly damaging 0.56
cradle UTSW 9 66,391,148 (GRCm39) splice site probably null
miracles UTSW 9 66,370,119 (GRCm39) nonsense probably null
newton UTSW 9 66,375,085 (GRCm39) missense probably damaging 1.00
R0907_Herc1_362 UTSW 9 66,340,710 (GRCm39) missense possibly damaging 0.94
R4427_Herc1_231 UTSW 9 66,403,287 (GRCm39) missense probably damaging 1.00
R5026_Herc1_363 UTSW 9 66,393,408 (GRCm39) missense probably benign 0.03
stables UTSW 9 66,386,735 (GRCm39) missense probably benign 0.13
strangle UTSW 9 66,408,470 (GRCm39) frame shift probably null
IGL03134:Herc1 UTSW 9 66,341,345 (GRCm39) critical splice acceptor site probably benign
PIT4243001:Herc1 UTSW 9 66,279,489 (GRCm39) missense probably benign 0.00
PIT4486001:Herc1 UTSW 9 66,279,671 (GRCm39) missense probably damaging 1.00
PIT4696001:Herc1 UTSW 9 66,386,291 (GRCm39) missense probably damaging 1.00
R0044:Herc1 UTSW 9 66,355,457 (GRCm39) missense probably benign 0.04
R0044:Herc1 UTSW 9 66,355,457 (GRCm39) missense probably benign 0.04
R0052:Herc1 UTSW 9 66,307,438 (GRCm39) missense probably damaging 0.99
R0114:Herc1 UTSW 9 66,369,128 (GRCm39) missense probably damaging 0.99
R0129:Herc1 UTSW 9 66,355,357 (GRCm39) missense probably damaging 1.00
R0131:Herc1 UTSW 9 66,388,192 (GRCm39) missense probably benign 0.00
R0131:Herc1 UTSW 9 66,388,192 (GRCm39) missense probably benign 0.00
R0132:Herc1 UTSW 9 66,388,192 (GRCm39) missense probably benign 0.00
R0158:Herc1 UTSW 9 66,403,203 (GRCm39) nonsense probably null
R0333:Herc1 UTSW 9 66,371,981 (GRCm39) splice site probably null
R0384:Herc1 UTSW 9 66,388,332 (GRCm39) splice site probably benign
R0419:Herc1 UTSW 9 66,353,356 (GRCm39) splice site probably benign
R0453:Herc1 UTSW 9 66,307,054 (GRCm39) missense probably benign 0.20
R0458:Herc1 UTSW 9 66,383,663 (GRCm39) missense probably benign 0.12
R0490:Herc1 UTSW 9 66,392,281 (GRCm39) missense probably damaging 1.00
R0506:Herc1 UTSW 9 66,355,441 (GRCm39) missense probably damaging 0.99
R0513:Herc1 UTSW 9 66,352,927 (GRCm39) missense possibly damaging 0.96
R0628:Herc1 UTSW 9 66,358,163 (GRCm39) missense probably benign 0.35
R0666:Herc1 UTSW 9 66,392,170 (GRCm39) splice site probably benign
R0674:Herc1 UTSW 9 66,408,474 (GRCm39) missense probably damaging 0.99
R0682:Herc1 UTSW 9 66,389,263 (GRCm39) missense possibly damaging 0.95
R0690:Herc1 UTSW 9 66,294,120 (GRCm39) nonsense probably null
R0701:Herc1 UTSW 9 66,395,232 (GRCm39) missense probably damaging 1.00
R0766:Herc1 UTSW 9 66,412,122 (GRCm39) missense probably damaging 1.00
R0850:Herc1 UTSW 9 66,373,952 (GRCm39) missense probably damaging 1.00
R0907:Herc1 UTSW 9 66,340,710 (GRCm39) missense possibly damaging 0.94
R0972:Herc1 UTSW 9 66,279,427 (GRCm39) missense probably damaging 1.00
R0976:Herc1 UTSW 9 66,347,160 (GRCm39) missense possibly damaging 0.74
R1027:Herc1 UTSW 9 66,363,250 (GRCm39) missense probably benign
R1200:Herc1 UTSW 9 66,393,406 (GRCm39) missense probably damaging 1.00
R1226:Herc1 UTSW 9 66,323,545 (GRCm39) missense probably benign 0.00
R1364:Herc1 UTSW 9 66,307,375 (GRCm39) missense probably damaging 1.00
R1395:Herc1 UTSW 9 66,346,463 (GRCm39) missense probably benign 0.13
R1432:Herc1 UTSW 9 66,372,751 (GRCm39) missense probably benign 0.13
R1440:Herc1 UTSW 9 66,375,085 (GRCm39) missense probably damaging 1.00
R1476:Herc1 UTSW 9 66,415,548 (GRCm39) missense probably damaging 1.00
R1590:Herc1 UTSW 9 66,399,235 (GRCm39) splice site probably benign
R1634:Herc1 UTSW 9 66,380,820 (GRCm39) missense possibly damaging 0.51
R1700:Herc1 UTSW 9 66,357,960 (GRCm39) splice site probably null
R1753:Herc1 UTSW 9 66,409,366 (GRCm39) critical splice donor site probably null
R1753:Herc1 UTSW 9 66,376,292 (GRCm39) missense probably damaging 1.00
R1796:Herc1 UTSW 9 66,296,138 (GRCm39) nonsense probably null
R1830:Herc1 UTSW 9 66,404,881 (GRCm39) missense possibly damaging 0.95
R1855:Herc1 UTSW 9 66,298,708 (GRCm39) missense possibly damaging 0.95
R1866:Herc1 UTSW 9 66,358,073 (GRCm39) missense probably damaging 1.00
R1894:Herc1 UTSW 9 66,386,743 (GRCm39) missense probably damaging 1.00
R1918:Herc1 UTSW 9 66,383,408 (GRCm39) splice site probably null
R1999:Herc1 UTSW 9 66,393,360 (GRCm39) missense probably benign 0.07
R2034:Herc1 UTSW 9 66,349,254 (GRCm39) missense probably benign 0.01
R2138:Herc1 UTSW 9 66,377,589 (GRCm39) missense possibly damaging 0.94
R2186:Herc1 UTSW 9 66,347,183 (GRCm39) missense probably benign 0.45
R2192:Herc1 UTSW 9 66,372,688 (GRCm39) missense probably damaging 0.99
R2312:Herc1 UTSW 9 66,415,563 (GRCm39) nonsense probably null
R2338:Herc1 UTSW 9 66,336,251 (GRCm39) missense possibly damaging 0.69
R3035:Herc1 UTSW 9 66,391,217 (GRCm39) missense possibly damaging 0.89
R3732:Herc1 UTSW 9 66,352,922 (GRCm39) missense probably damaging 1.00
R3732:Herc1 UTSW 9 66,352,922 (GRCm39) missense probably damaging 1.00
R3733:Herc1 UTSW 9 66,352,922 (GRCm39) missense probably damaging 1.00
R3917:Herc1 UTSW 9 66,341,748 (GRCm39) missense possibly damaging 0.94
R3953:Herc1 UTSW 9 66,341,075 (GRCm39) nonsense probably null
R4073:Herc1 UTSW 9 66,325,774 (GRCm39) missense probably benign 0.12
R4075:Herc1 UTSW 9 66,325,774 (GRCm39) missense probably benign 0.12
R4241:Herc1 UTSW 9 66,355,630 (GRCm39) frame shift probably null
R4260:Herc1 UTSW 9 66,355,630 (GRCm39) frame shift probably null
R4261:Herc1 UTSW 9 66,355,630 (GRCm39) frame shift probably null
R4300:Herc1 UTSW 9 66,396,688 (GRCm39) missense probably damaging 1.00
R4398:Herc1 UTSW 9 66,386,735 (GRCm39) missense probably benign 0.13
R4426:Herc1 UTSW 9 66,403,287 (GRCm39) missense probably damaging 1.00
R4427:Herc1 UTSW 9 66,403,287 (GRCm39) missense probably damaging 1.00
R4590:Herc1 UTSW 9 66,344,946 (GRCm39) missense probably damaging 0.97
R4630:Herc1 UTSW 9 66,340,996 (GRCm39) splice site probably null
R4656:Herc1 UTSW 9 66,301,993 (GRCm39) missense probably damaging 0.97
R4658:Herc1 UTSW 9 66,386,773 (GRCm39) missense possibly damaging 0.50
R4663:Herc1 UTSW 9 66,340,660 (GRCm39) missense probably damaging 0.98
R4675:Herc1 UTSW 9 66,298,740 (GRCm39) missense probably damaging 1.00
R4678:Herc1 UTSW 9 66,323,551 (GRCm39) missense probably benign 0.00
R4754:Herc1 UTSW 9 66,408,488 (GRCm39) missense probably benign 0.00
R4766:Herc1 UTSW 9 66,349,211 (GRCm39) missense probably benign 0.00
R4792:Herc1 UTSW 9 66,403,266 (GRCm39) missense possibly damaging 0.67
R4828:Herc1 UTSW 9 66,404,625 (GRCm39) splice site probably null
R4832:Herc1 UTSW 9 66,403,253 (GRCm39) missense probably benign 0.11
R4879:Herc1 UTSW 9 66,370,119 (GRCm39) nonsense probably null
R4948:Herc1 UTSW 9 66,392,184 (GRCm39) missense probably benign
R5021:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5022:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5024:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5025:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5026:Herc1 UTSW 9 66,393,408 (GRCm39) missense probably benign 0.03
R5027:Herc1 UTSW 9 66,380,811 (GRCm39) missense probably benign 0.01
R5027:Herc1 UTSW 9 66,411,900 (GRCm39) missense probably damaging 0.98
R5038:Herc1 UTSW 9 66,383,742 (GRCm39) intron probably benign
R5041:Herc1 UTSW 9 66,336,327 (GRCm39) missense possibly damaging 0.86
R5053:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5137:Herc1 UTSW 9 66,355,505 (GRCm39) missense probably benign
R5197:Herc1 UTSW 9 66,355,786 (GRCm39) missense probably damaging 0.99
R5207:Herc1 UTSW 9 66,307,151 (GRCm39) nonsense probably null
R5247:Herc1 UTSW 9 66,341,833 (GRCm39) missense probably benign 0.01
R5267:Herc1 UTSW 9 66,369,091 (GRCm39) missense probably damaging 1.00
R5274:Herc1 UTSW 9 66,306,691 (GRCm39) missense probably benign
R5375:Herc1 UTSW 9 66,375,169 (GRCm39) missense probably damaging 0.99
R5401:Herc1 UTSW 9 66,409,338 (GRCm39) missense probably damaging 1.00
R5560:Herc1 UTSW 9 66,358,401 (GRCm39) missense probably benign 0.02
R5566:Herc1 UTSW 9 66,372,819 (GRCm39) missense possibly damaging 0.95
R5577:Herc1 UTSW 9 66,389,263 (GRCm39) missense probably damaging 0.99
R5596:Herc1 UTSW 9 66,341,345 (GRCm39) critical splice acceptor site probably benign
R5665:Herc1 UTSW 9 66,372,717 (GRCm39) missense probably damaging 1.00
R5744:Herc1 UTSW 9 66,415,475 (GRCm39) missense probably damaging 1.00
R5802:Herc1 UTSW 9 66,370,160 (GRCm39) missense probably damaging 1.00
R5822:Herc1 UTSW 9 66,352,894 (GRCm39) missense probably benign 0.00
R5954:Herc1 UTSW 9 66,358,774 (GRCm39) splice site probably benign
R5977:Herc1 UTSW 9 66,340,604 (GRCm39) missense possibly damaging 0.77
R6022:Herc1 UTSW 9 66,390,967 (GRCm39) missense probably damaging 1.00
R6043:Herc1 UTSW 9 66,315,436 (GRCm39) missense probably benign
R6046:Herc1 UTSW 9 66,352,831 (GRCm39) missense probably damaging 0.99
R6089:Herc1 UTSW 9 66,352,814 (GRCm39) missense probably damaging 1.00
R6123:Herc1 UTSW 9 66,404,532 (GRCm39) missense probably damaging 0.97
R6155:Herc1 UTSW 9 66,340,705 (GRCm39) missense possibly damaging 0.95
R6190:Herc1 UTSW 9 66,283,663 (GRCm39) missense possibly damaging 0.56
R6220:Herc1 UTSW 9 66,341,070 (GRCm39) missense probably damaging 1.00
R6265:Herc1 UTSW 9 66,279,298 (GRCm39) missense probably benign 0.05
R6348:Herc1 UTSW 9 66,395,258 (GRCm39) missense possibly damaging 0.77
R6362:Herc1 UTSW 9 66,379,190 (GRCm39) missense probably damaging 1.00
R6394:Herc1 UTSW 9 66,302,341 (GRCm39) missense probably damaging 0.99
R6434:Herc1 UTSW 9 66,393,464 (GRCm39) missense probably damaging 0.99
R6483:Herc1 UTSW 9 66,355,811 (GRCm39) missense possibly damaging 0.64
R6607:Herc1 UTSW 9 66,325,849 (GRCm39) missense probably benign 0.02
R6633:Herc1 UTSW 9 66,346,534 (GRCm39) nonsense probably null
R6634:Herc1 UTSW 9 66,345,026 (GRCm39) missense probably benign
R6693:Herc1 UTSW 9 66,386,258 (GRCm39) missense probably damaging 0.99
R6695:Herc1 UTSW 9 66,391,148 (GRCm39) splice site probably null
R6748:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6750:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6751:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6774:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6785:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6786:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6856:Herc1 UTSW 9 66,305,180 (GRCm39) missense probably benign 0.05
R6966:Herc1 UTSW 9 66,318,347 (GRCm39) missense probably benign 0.07
R7020:Herc1 UTSW 9 66,393,360 (GRCm39) missense probably benign 0.07
R7109:Herc1 UTSW 9 66,389,171 (GRCm39) missense probably benign 0.03
R7122:Herc1 UTSW 9 66,307,056 (GRCm39) missense possibly damaging 0.69
R7209:Herc1 UTSW 9 66,292,314 (GRCm39) missense possibly damaging 0.95
R7222:Herc1 UTSW 9 66,374,781 (GRCm39) missense probably damaging 0.98
R7303:Herc1 UTSW 9 66,358,098 (GRCm39) missense possibly damaging 0.93
R7305:Herc1 UTSW 9 66,369,150 (GRCm39) missense
R7438:Herc1 UTSW 9 66,302,038 (GRCm39) missense probably benign 0.00
R7535:Herc1 UTSW 9 66,382,135 (GRCm39) missense probably damaging 1.00
R7585:Herc1 UTSW 9 66,352,829 (GRCm39) missense probably damaging 1.00
R7603:Herc1 UTSW 9 66,358,665 (GRCm39) nonsense probably null
R7670:Herc1 UTSW 9 66,323,629 (GRCm39) missense probably damaging 0.99
R7705:Herc1 UTSW 9 66,347,116 (GRCm39) missense possibly damaging 0.86
R7723:Herc1 UTSW 9 66,279,158 (GRCm39) missense probably benign 0.24
R7730:Herc1 UTSW 9 66,400,472 (GRCm39) small deletion probably benign
R7880:Herc1 UTSW 9 66,415,506 (GRCm39) missense probably damaging 0.99
R7958:Herc1 UTSW 9 66,393,475 (GRCm39) missense probably damaging 1.00
R7976:Herc1 UTSW 9 66,341,552 (GRCm39) missense possibly damaging 0.94
R8006:Herc1 UTSW 9 66,352,842 (GRCm39) nonsense probably null
R8084:Herc1 UTSW 9 66,383,217 (GRCm39) missense probably benign 0.45
R8094:Herc1 UTSW 9 66,400,462 (GRCm39) missense probably damaging 0.98
R8099:Herc1 UTSW 9 66,279,422 (GRCm39) missense probably damaging 1.00
R8151:Herc1 UTSW 9 66,341,073 (GRCm39) missense probably damaging 0.98
R8159:Herc1 UTSW 9 66,369,003 (GRCm39) missense probably null
R8190:Herc1 UTSW 9 66,325,733 (GRCm39) missense probably benign 0.00
R8213:Herc1 UTSW 9 66,358,170 (GRCm39) missense probably damaging 0.99
R8230:Herc1 UTSW 9 66,377,598 (GRCm39) missense probably damaging 0.99
R8265:Herc1 UTSW 9 66,293,986 (GRCm39) nonsense probably null
R8270:Herc1 UTSW 9 66,395,232 (GRCm39) missense probably damaging 1.00
R8353:Herc1 UTSW 9 66,415,571 (GRCm39) missense possibly damaging 0.88
R8423:Herc1 UTSW 9 66,415,442 (GRCm39) missense probably damaging 0.99
R8506:Herc1 UTSW 9 66,380,863 (GRCm39) missense possibly damaging 0.52
R8523:Herc1 UTSW 9 66,358,224 (GRCm39) missense probably benign
R8530:Herc1 UTSW 9 66,325,910 (GRCm39) missense probably benign
R8545:Herc1 UTSW 9 66,279,257 (GRCm39) nonsense probably null
R8682:Herc1 UTSW 9 66,370,130 (GRCm39) missense
R8720:Herc1 UTSW 9 66,389,105 (GRCm39) missense probably benign 0.38
R8792:Herc1 UTSW 9 66,372,768 (GRCm39) missense probably damaging 1.00
R8915:Herc1 UTSW 9 66,318,456 (GRCm39) missense probably damaging 1.00
R8964:Herc1 UTSW 9 66,352,872 (GRCm39) missense probably damaging 1.00
R9056:Herc1 UTSW 9 66,380,782 (GRCm39) missense probably benign 0.10
R9158:Herc1 UTSW 9 66,376,400 (GRCm39) missense probably benign 0.00
R9167:Herc1 UTSW 9 66,411,900 (GRCm39) missense possibly damaging 0.75
R9192:Herc1 UTSW 9 66,321,413 (GRCm39) missense probably benign 0.35
R9252:Herc1 UTSW 9 66,309,834 (GRCm39) missense probably damaging 1.00
R9260:Herc1 UTSW 9 66,325,691 (GRCm39) nonsense probably null
R9261:Herc1 UTSW 9 66,412,129 (GRCm39) missense probably damaging 0.98
R9430:Herc1 UTSW 9 66,325,785 (GRCm39) nonsense probably null
R9519:Herc1 UTSW 9 66,307,356 (GRCm39) missense probably damaging 0.97
R9563:Herc1 UTSW 9 66,294,193 (GRCm39) critical splice donor site probably null
R9589:Herc1 UTSW 9 66,372,840 (GRCm39) missense possibly damaging 0.95
R9600:Herc1 UTSW 9 66,304,594 (GRCm39) missense possibly damaging 0.95
R9659:Herc1 UTSW 9 66,307,185 (GRCm39) missense probably benign 0.03
R9740:Herc1 UTSW 9 66,355,796 (GRCm39) missense probably damaging 1.00
R9774:Herc1 UTSW 9 66,372,032 (GRCm39) missense probably null
R9781:Herc1 UTSW 9 66,280,004 (GRCm39) missense probably benign
R9788:Herc1 UTSW 9 66,307,185 (GRCm39) missense probably benign 0.03
RF023:Herc1 UTSW 9 66,365,616 (GRCm39) missense
X0011:Herc1 UTSW 9 66,307,441 (GRCm39) missense probably benign 0.28
X0067:Herc1 UTSW 9 66,355,806 (GRCm39) missense probably benign 0.03
Z1176:Herc1 UTSW 9 66,341,858 (GRCm39) missense probably benign
Z1177:Herc1 UTSW 9 66,379,193 (GRCm39) missense probably damaging 0.99
Z1177:Herc1 UTSW 9 66,365,707 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- GAAGATTGAGCCTAGTAATCTAATGGC -3'
(R):5'- GGAAAGGTAAATGTGCATTCTGTAG -3'

Sequencing Primer
(F):5'- CTCAAAATTTGGCTTGGC -3'
(R):5'- CCAAAGACTGCTCCAGT -3'
Posted On 2016-06-06