Incidental Mutation 'R5023:Ttk'
ID 391133
Institutional Source Beutler Lab
Gene Symbol Ttk
Ensembl Gene ENSMUSG00000038379
Gene Name Ttk protein kinase
Synonyms Mps1, Esk1
MMRRC Submission 042614-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock # R5023 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 83834689-83872389 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83863541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 647 (D647G)
Ref Sequence ENSEMBL: ENSMUSP00000139956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070326] [ENSMUST00000185913]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000070326
AA Change: D647G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064839
Gene: ENSMUSG00000038379
AA Change: D647G

DomainStartEndE-ValueType
PDB:4B94|D 55 235 7e-97 PDB
low complexity region 459 487 N/A INTRINSIC
S_TKc 498 764 1.14e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185913
AA Change: D647G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139956
Gene: ENSMUSG00000038379
AA Change: D647G

DomainStartEndE-ValueType
PDB:4B94|D 55 235 2e-97 PDB
low complexity region 459 487 N/A INTRINSIC
Pfam:Pkinase 498 661 7.9e-36 PFAM
Pfam:Pkinase_Tyr 498 661 6.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188445
Meta Mutation Damage Score 0.1871 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (127/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase with the ability to phosphorylate tyrosine, serine and threonine. Associated with cell proliferation, this protein is essential for chromosome alignment at the centromere during mitosis and is required for centrosome duplication. It has been found to be a critical mitotic checkpoint protein for accurate segregation of chromosomes during mitosis. Tumorigenesis may occur when this protein fails to degrade and produces excess centrosomes resulting in aberrant mitotic spindles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a floxed allele activated in oocytes exhibit reduced female fertility associated with defective spindle assembly checkpoint, premature chromosome segregation, and accelerated anaphase and polar body extrusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abca8b A G 11: 109,974,988 probably null Het
Adam1b C T 5: 121,501,159 V608M probably damaging Het
Ank2 A G 3: 126,941,871 probably benign Het
Ankrd17 A C 5: 90,282,868 L1019R probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Best3 G A 10: 116,988,742 V38I probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Cage1 G T 13: 38,011,411 S778* probably null Het
Capn7 T A 14: 31,352,426 V262E probably damaging Het
Ccdc190 A G 1: 169,933,087 R95G probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh18 G A 15: 23,259,666 S194N probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Ctsw T A 19: 5,466,049 D237V probably damaging Het
Cyp2c68 G A 19: 39,712,507 T289I probably benign Het
Cyp4f39 A G 17: 32,481,104 Y133C probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dnah7a C A 1: 53,647,248 E248* probably null Het
Eef2kmt T A 16: 5,247,599 D248V probably damaging Het
Ewsr1 T C 11: 5,088,054 T113A possibly damaging Het
Fbxo4 A G 15: 3,977,756 probably null Het
Fbxo43 A T 15: 36,162,929 M44K probably benign Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fgf5 C A 5: 98,262,015 A141E probably damaging Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Glp2r T C 11: 67,741,032 T121A possibly damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5155 A T 7: 17,902,706 D236V probably damaging Het
Gm7030 A G 17: 36,109,415 probably benign Het
Gnb2 G A 5: 137,529,940 probably null Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpx5 C T 13: 21,288,745 V140I probably damaging Het
Gtpbp1 A T 15: 79,719,221 Q637L possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hhat A T 1: 192,727,339 L138Q probably damaging Het
Hipk1 G T 3: 103,777,507 T264N probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Hook3 TAGAG TAG 8: 26,032,019 probably null Het
Ifi204 G A 1: 173,751,740 T513I possibly damaging Het
Ino80b G T 6: 83,125,042 S26R probably damaging Het
Ints9 T A 14: 64,980,228 L68H probably damaging Het
Isx C T 8: 74,892,714 T178I probably benign Het
Kel A G 6: 41,688,111 L255P probably damaging Het
Klf11 T A 12: 24,655,359 S271T probably benign Het
Klhl20 A C 1: 161,109,220 probably null Het
Lama2 G A 10: 27,190,504 T1127I probably damaging Het
Larp1b T A 3: 41,033,985 N81K possibly damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Map3k20 T A 2: 72,402,345 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Mybpc1 T G 10: 88,543,774 D635A probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Ndufa7 A G 17: 33,824,603 probably benign Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nme4 G A 17: 26,093,668 T129I probably benign Het
Npffr2 A T 5: 89,582,687 T159S probably benign Het
Nup153 A T 13: 46,681,109 probably benign Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr616 A C 7: 103,565,171 M36R possibly damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcca A G 14: 122,790,398 N73D probably damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Pkhd1l1 G A 15: 44,582,227 M3768I probably benign Het
Ppa2 A G 3: 133,370,434 M275V probably benign Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Ptprv A T 1: 135,124,506 noncoding transcript Het
Rad17 A T 13: 100,645,063 H75Q possibly damaging Het
Rbm44 T C 1: 91,169,098 probably null Het
Rbpj C T 5: 53,649,415 R201W probably damaging Het
Rbpjl C A 2: 164,410,289 L215I probably damaging Het
Ror1 A G 4: 100,425,932 E398G probably benign Het
Scamp3 T A 3: 89,182,293 probably benign Het
Selenot CATGTATG CATGTATGTATG 3: 58,588,453 probably null Het
Siglec15 A G 18: 78,048,675 C104R probably damaging Het
Sis T C 3: 72,934,122 I787V probably benign Het
Slc17a8 T C 10: 89,576,560 D521G probably benign Het
Slc7a10 T A 7: 35,197,355 M172K possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Smg8 A C 11: 87,086,137 V206G probably damaging Het
Smg9 A G 7: 24,405,872 K137R possibly damaging Het
Srrm2 C A 17: 23,819,317 probably benign Het
Sult2a2 T A 7: 13,734,860 Y84N possibly damaging Het
Syngr2 A T 11: 117,812,510 I34F probably benign Het
Tank G A 2: 61,578,635 probably benign Het
Tead4 T C 6: 128,294,171 probably benign Het
Tex36 A T 7: 133,595,290 C33S probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tmem240 T A 4: 155,739,674 L92Q probably damaging Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tmod3 G A 9: 75,511,206 P183S probably damaging Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim16 A T 11: 62,836,812 Y233F probably benign Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttc3 A G 16: 94,429,359 E450G probably benign Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Vmn1r29 T A 6: 58,308,067 Y257* probably null Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zbtb11 A G 16: 56,006,065 Y819C probably damaging Het
Zfp112 A G 7: 24,126,484 T624A probably damaging Het
Zfp592 A G 7: 81,024,347 D353G probably damaging Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Zfp677 A T 17: 21,397,794 H371L probably damaging Het
Zfp780b T C 7: 27,963,448 K561E possibly damaging Het
Zfp936 G A 7: 43,187,257 D31N probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Zpbp C T 11: 11,415,248 E200K probably benign Het
Other mutations in Ttk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00721:Ttk APN 9 83863448 missense probably damaging 1.00
IGL01298:Ttk APN 9 83865142 missense probably benign 0.27
IGL02806:Ttk APN 9 83862487 nonsense probably null
IGL03080:Ttk APN 9 83843083 missense probably damaging 1.00
R0396:Ttk UTSW 9 83847260 unclassified probably benign
R0507:Ttk UTSW 9 83868067 missense probably damaging 0.97
R0827:Ttk UTSW 9 83843915 missense probably benign
R1077:Ttk UTSW 9 83844149 unclassified probably benign
R1730:Ttk UTSW 9 83868592 missense possibly damaging 0.86
R1844:Ttk UTSW 9 83854862 missense possibly damaging 0.55
R1856:Ttk UTSW 9 83869263 missense probably damaging 1.00
R1941:Ttk UTSW 9 83853126 missense probably benign 0.22
R2191:Ttk UTSW 9 83862183 missense probably damaging 0.99
R3737:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4035:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4903:Ttk UTSW 9 83865148 missense probably benign 0.42
R4908:Ttk UTSW 9 83843686 missense possibly damaging 0.96
R4966:Ttk UTSW 9 83865148 missense probably benign 0.42
R5197:Ttk UTSW 9 83839341 missense probably benign
R5567:Ttk UTSW 9 83862535 missense possibly damaging 0.94
R6022:Ttk UTSW 9 83839322 missense probably damaging 1.00
R6900:Ttk UTSW 9 83872030 missense probably damaging 0.96
R7039:Ttk UTSW 9 83868092 missense probably damaging 1.00
R7373:Ttk UTSW 9 83854877 missense probably benign 0.00
R7715:Ttk UTSW 9 83865153 missense probably benign 0.10
R7846:Ttk UTSW 9 83843679 missense probably benign 0.27
R8189:Ttk UTSW 9 83847219 missense probably benign 0.38
R8520:Ttk UTSW 9 83857327 missense possibly damaging 0.93
R8880:Ttk UTSW 9 83869251 missense probably damaging 1.00
R8903:Ttk UTSW 9 83868060 missense probably damaging 1.00
R8919:Ttk UTSW 9 83839269 missense probably damaging 1.00
R9105:Ttk UTSW 9 83863491 missense probably damaging 1.00
R9142:Ttk UTSW 9 83843688 missense probably damaging 0.99
R9434:Ttk UTSW 9 83868090 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATAAGCCTGACCTAAAGATTATG -3'
(R):5'- AAGCCTTGTAGTAACCAGCCATC -3'

Sequencing Primer
(F):5'- GCCTGACCTAAAGATTATGAAATGC -3'
(R):5'- TGTCGGGGCTGACACCTATAAG -3'
Posted On 2016-06-06