Incidental Mutation 'R5023:Abca8b'
ID391154
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission 042614-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5023 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 109974988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect probably null
Transcript: ENSMUST00000020948
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106669
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (127/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adam1b C T 5: 121,501,159 V608M probably damaging Het
Ank2 A G 3: 126,941,871 probably benign Het
Ankrd17 A C 5: 90,282,868 L1019R probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Best3 G A 10: 116,988,742 V38I probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Cage1 G T 13: 38,011,411 S778* probably null Het
Capn7 T A 14: 31,352,426 V262E probably damaging Het
Ccdc190 A G 1: 169,933,087 R95G probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh18 G A 15: 23,259,666 S194N probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Ctsw T A 19: 5,466,049 D237V probably damaging Het
Cyp2c68 G A 19: 39,712,507 T289I probably benign Het
Cyp4f39 A G 17: 32,481,104 Y133C probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dnah7a C A 1: 53,647,248 E248* probably null Het
Eef2kmt T A 16: 5,247,599 D248V probably damaging Het
Ewsr1 T C 11: 5,088,054 T113A possibly damaging Het
Fbxo4 A G 15: 3,977,756 probably null Het
Fbxo43 A T 15: 36,162,929 M44K probably benign Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fgf5 C A 5: 98,262,015 A141E probably damaging Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Glp2r T C 11: 67,741,032 T121A possibly damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5155 A T 7: 17,902,706 D236V probably damaging Het
Gm7030 A G 17: 36,109,415 probably benign Het
Gnb2 G A 5: 137,529,940 probably null Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpx5 C T 13: 21,288,745 V140I probably damaging Het
Gtpbp1 A T 15: 79,719,221 Q637L possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hhat A T 1: 192,727,339 L138Q probably damaging Het
Hipk1 G T 3: 103,777,507 T264N probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Hook3 TAGAG TAG 8: 26,032,019 probably null Het
Ifi204 G A 1: 173,751,740 T513I possibly damaging Het
Ino80b G T 6: 83,125,042 S26R probably damaging Het
Ints9 T A 14: 64,980,228 L68H probably damaging Het
Isx C T 8: 74,892,714 T178I probably benign Het
Kel A G 6: 41,688,111 L255P probably damaging Het
Klf11 T A 12: 24,655,359 S271T probably benign Het
Klhl20 A C 1: 161,109,220 probably null Het
Lama2 G A 10: 27,190,504 T1127I probably damaging Het
Larp1b T A 3: 41,033,985 N81K possibly damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Map3k20 T A 2: 72,402,345 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Mybpc1 T G 10: 88,543,774 D635A probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Ndufa7 A G 17: 33,824,603 probably benign Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nme4 G A 17: 26,093,668 T129I probably benign Het
Npffr2 A T 5: 89,582,687 T159S probably benign Het
Nup153 A T 13: 46,681,109 probably benign Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr616 A C 7: 103,565,171 M36R possibly damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcca A G 14: 122,790,398 N73D probably damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Pkhd1l1 G A 15: 44,582,227 M3768I probably benign Het
Ppa2 A G 3: 133,370,434 M275V probably benign Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Ptprv A T 1: 135,124,506 noncoding transcript Het
Rad17 A T 13: 100,645,063 H75Q possibly damaging Het
Rbm44 T C 1: 91,169,098 probably null Het
Rbpj C T 5: 53,649,415 R201W probably damaging Het
Rbpjl C A 2: 164,410,289 L215I probably damaging Het
Ror1 A G 4: 100,425,932 E398G probably benign Het
Scamp3 T A 3: 89,182,293 probably benign Het
Selenot CATGTATG CATGTATGTATG 3: 58,588,453 probably null Het
Siglec15 A G 18: 78,048,675 C104R probably damaging Het
Sis T C 3: 72,934,122 I787V probably benign Het
Slc17a8 T C 10: 89,576,560 D521G probably benign Het
Slc7a10 T A 7: 35,197,355 M172K possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Smg8 A C 11: 87,086,137 V206G probably damaging Het
Smg9 A G 7: 24,405,872 K137R possibly damaging Het
Srrm2 C A 17: 23,819,317 probably benign Het
Sult2a2 T A 7: 13,734,860 Y84N possibly damaging Het
Syngr2 A T 11: 117,812,510 I34F probably benign Het
Tank G A 2: 61,578,635 probably benign Het
Tead4 T C 6: 128,294,171 probably benign Het
Tex36 A T 7: 133,595,290 C33S probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tmem240 T A 4: 155,739,674 L92Q probably damaging Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tmod3 G A 9: 75,511,206 P183S probably damaging Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim16 A T 11: 62,836,812 Y233F probably benign Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttc3 A G 16: 94,429,359 E450G probably benign Het
Ttk A G 9: 83,863,541 D647G probably damaging Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Vmn1r29 T A 6: 58,308,067 Y257* probably null Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zbtb11 A G 16: 56,006,065 Y819C probably damaging Het
Zfp112 A G 7: 24,126,484 T624A probably damaging Het
Zfp592 A G 7: 81,024,347 D353G probably damaging Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Zfp677 A T 17: 21,397,794 H371L probably damaging Het
Zfp780b T C 7: 27,963,448 K561E possibly damaging Het
Zfp936 G A 7: 43,187,257 D31N probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Zpbp C T 11: 11,415,248 E200K probably benign Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 intron probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
R7590:Abca8b UTSW 11 109938515 missense probably damaging 0.97
R7658:Abca8b UTSW 11 109935717 missense probably benign 0.00
R7739:Abca8b UTSW 11 109974591 missense probably benign 0.05
R7797:Abca8b UTSW 11 109971683 critical splice donor site probably null
R8074:Abca8b UTSW 11 109938494 missense probably benign
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Z1176:Abca8b UTSW 11 109961908 missense possibly damaging 0.52
Z1176:Abca8b UTSW 11 109974644 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GACCCAGGTGGCTTTCATTTATC -3'
(R):5'- CTGCCATGTTTCAAAGACTAAAAGGG -3'

Sequencing Primer
(F):5'- CTTGCAACTGTGCTACACA -3'
(R):5'- GGGAATTTTATTTCCACACCAGGC -3'
Posted On2016-06-06