Incidental Mutation 'R5023:Cage1'
ID 391159
Institutional Source Beutler Lab
Gene Symbol Cage1
Ensembl Gene ENSMUSG00000044566
Gene Name cancer antigen 1
Synonyms Ctag3, CAGE1, 4933427I01Rik
MMRRC Submission 042614-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R5023 (G1)
Quality Score 207
Status Validated
Chromosome 13
Chromosomal Location 38190028-38221045 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 38195387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 778 (S778*)
Ref Sequence ENSEMBL: ENSMUSP00000105862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074969] [ENSMUST00000110233]
AlphaFold Q5IR70
Predicted Effect probably null
Transcript: ENSMUST00000074969
AA Change: S778*
SMART Domains Protein: ENSMUSP00000074499
Gene: ENSMUSG00000044566
AA Change: S778*

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 5.1e-292 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110233
AA Change: S778*
SMART Domains Protein: ENSMUSP00000105862
Gene: ENSMUSG00000044566
AA Change: S778*

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 2.4e-255 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (127/129)
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,057,581 (GRCm39) H739Q probably benign Het
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Abca8b A G 11: 109,865,814 (GRCm39) probably null Het
Adam1b C T 5: 121,639,222 (GRCm39) V608M probably damaging Het
Ank2 A G 3: 126,735,520 (GRCm39) probably benign Het
Ankrd17 A C 5: 90,430,727 (GRCm39) L1019R probably damaging Het
Arih1 T C 9: 59,393,515 (GRCm39) N39S unknown Het
Best3 G A 10: 116,824,647 (GRCm39) V38I probably benign Het
Bicc1 A G 10: 70,783,713 (GRCm39) S393P possibly damaging Het
C1d T A 11: 17,216,674 (GRCm39) N135K probably benign Het
Capn7 T A 14: 31,074,383 (GRCm39) V262E probably damaging Het
Ccdc190 A G 1: 169,760,656 (GRCm39) R95G probably damaging Het
Cd163 C T 6: 124,302,247 (GRCm39) T937I probably damaging Het
Cdh18 G A 15: 23,259,752 (GRCm39) S194N probably damaging Het
Ceacam23 A T 7: 17,636,631 (GRCm39) D236V probably damaging Het
Clec4b2 A T 6: 123,177,915 (GRCm39) S77C probably null Het
Ctsw T A 19: 5,516,077 (GRCm39) D237V probably damaging Het
Cyp2c68 G A 19: 39,700,951 (GRCm39) T289I probably benign Het
Cyp4f39 A G 17: 32,700,078 (GRCm39) Y133C probably damaging Het
Dlg5 T C 14: 24,186,690 (GRCm39) E1847G probably damaging Het
Dnah7a C A 1: 53,686,407 (GRCm39) E248* probably null Het
Eef2kmt T A 16: 5,065,463 (GRCm39) D248V probably damaging Het
Ewsr1 T C 11: 5,038,054 (GRCm39) T113A possibly damaging Het
Fbxo4 A G 15: 4,007,238 (GRCm39) probably null Het
Fbxo43 A T 15: 36,163,075 (GRCm39) M44K probably benign Het
Fchsd1 A G 18: 38,097,863 (GRCm39) I340T possibly damaging Het
Fgf5 C A 5: 98,409,874 (GRCm39) A141E probably damaging Het
Gfm1 T C 3: 67,380,877 (GRCm39) V664A probably damaging Het
Glp2r T C 11: 67,631,858 (GRCm39) T121A possibly damaging Het
Gm10803 A C 2: 93,394,517 (GRCm39) L96F probably damaging Het
Gm14569 T C X: 35,694,470 (GRCm39) D1413G probably benign Het
Gm15455 T C 1: 33,876,432 (GRCm39) noncoding transcript Het
Gm1818 G C 12: 48,602,318 (GRCm39) noncoding transcript Het
Gnb2 G A 5: 137,528,202 (GRCm39) probably null Het
Gpc4 G A X: 51,163,440 (GRCm39) R148C probably damaging Het
Gpx5 C T 13: 21,472,915 (GRCm39) V140I probably damaging Het
Gtpbp1 A T 15: 79,603,422 (GRCm39) Q637L possibly damaging Het
H2-T9 A G 17: 36,420,307 (GRCm39) probably benign Het
Herc1 A T 9: 66,377,608 (GRCm39) K3458M possibly damaging Het
Hhat A T 1: 192,409,647 (GRCm39) L138Q probably damaging Het
Hipk1 G T 3: 103,684,823 (GRCm39) T264N probably damaging Het
Hjurp A T 1: 88,202,772 (GRCm39) Y71N possibly damaging Het
Hnf4g G T 3: 3,709,647 (GRCm39) A144S probably damaging Het
Hook3 TAGAG TAG 8: 26,522,047 (GRCm39) probably null Het
Ifi204 G A 1: 173,579,306 (GRCm39) T513I possibly damaging Het
Ino80b G T 6: 83,102,023 (GRCm39) S26R probably damaging Het
Ints9 T A 14: 65,217,677 (GRCm39) L68H probably damaging Het
Isx C T 8: 75,619,342 (GRCm39) T178I probably benign Het
Kel A G 6: 41,665,045 (GRCm39) L255P probably damaging Het
Klf11 T A 12: 24,705,358 (GRCm39) S271T probably benign Het
Klhl20 A C 1: 160,936,790 (GRCm39) probably null Het
Lama2 G A 10: 27,066,500 (GRCm39) T1127I probably damaging Het
Larp1b T A 3: 40,988,420 (GRCm39) N81K possibly damaging Het
Lsm11 T C 11: 45,835,666 (GRCm39) D25G probably damaging Het
Map3k20 T A 2: 72,232,689 (GRCm39) probably benign Het
Mbd6 C T 10: 127,122,310 (GRCm39) V173I probably benign Het
Milr1 A G 11: 106,657,791 (GRCm39) D131G possibly damaging Het
Mybpc1 T G 10: 88,379,636 (GRCm39) D635A probably damaging Het
Myh7b G C 2: 155,474,293 (GRCm39) R1669S possibly damaging Het
Ndufa7 A G 17: 34,043,577 (GRCm39) probably benign Het
Ndufs3 C A 2: 90,729,004 (GRCm39) A161S probably benign Het
Neo1 T C 9: 58,897,554 (GRCm39) D134G probably damaging Het
Nme4 G A 17: 26,312,642 (GRCm39) T129I probably benign Het
Npffr2 A T 5: 89,730,546 (GRCm39) T159S probably benign Het
Nup153 A T 13: 46,834,585 (GRCm39) probably benign Het
Or3a10 T A 11: 73,935,881 (GRCm39) D73V probably damaging Het
Or51ac3 A C 7: 103,214,378 (GRCm39) M36R possibly damaging Het
Pate2 T C 9: 35,597,407 (GRCm39) probably benign Het
Pcca A G 14: 123,027,810 (GRCm39) N73D probably damaging Het
Pip5k1c G A 10: 81,146,723 (GRCm39) probably null Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Pkhd1l1 G A 15: 44,445,623 (GRCm39) M3768I probably benign Het
Ppa2 A G 3: 133,076,195 (GRCm39) M275V probably benign Het
Ptpn23 G A 9: 110,217,624 (GRCm39) T744I probably benign Het
Ptprv A T 1: 135,052,244 (GRCm39) noncoding transcript Het
Rad17 A T 13: 100,781,571 (GRCm39) H75Q possibly damaging Het
Rbm44 T C 1: 91,096,820 (GRCm39) probably null Het
Rbpj C T 5: 53,806,757 (GRCm39) R201W probably damaging Het
Rbpjl C A 2: 164,252,209 (GRCm39) L215I probably damaging Het
Ror1 A G 4: 100,283,129 (GRCm39) E398G probably benign Het
Scamp3 T A 3: 89,089,600 (GRCm39) probably benign Het
Selenot CATGTATG CATGTATGTATG 3: 58,495,874 (GRCm39) probably null Het
Siglec15 A G 18: 78,091,890 (GRCm39) C104R probably damaging Het
Sis T C 3: 72,841,455 (GRCm39) I787V probably benign Het
Slc17a8 T C 10: 89,412,422 (GRCm39) D521G probably benign Het
Slc7a10 T A 7: 34,896,780 (GRCm39) M172K possibly damaging Het
Slco4c1 G A 1: 96,768,953 (GRCm39) P303L probably damaging Het
Slitrk3 T C 3: 72,957,981 (GRCm39) T264A probably benign Het
Smg8 A C 11: 86,976,963 (GRCm39) V206G probably damaging Het
Smg9 A G 7: 24,105,297 (GRCm39) K137R possibly damaging Het
Srrm2 C A 17: 24,038,291 (GRCm39) probably benign Het
Sult2a2 T A 7: 13,468,785 (GRCm39) Y84N possibly damaging Het
Syngr2 A T 11: 117,703,336 (GRCm39) I34F probably benign Het
Tank G A 2: 61,408,979 (GRCm39) probably benign Het
Tead4 T C 6: 128,271,134 (GRCm39) probably benign Het
Tesl1 G A X: 23,773,480 (GRCm39) G327E probably damaging Het
Tex36 A T 7: 133,197,019 (GRCm39) C33S probably benign Het
Timd5 T A 11: 46,419,359 (GRCm39) D58E probably damaging Het
Timm21 C A 18: 84,967,539 (GRCm39) V112L possibly damaging Het
Tmem240 T A 4: 155,824,131 (GRCm39) L92Q probably damaging Het
Tmem268 C G 4: 63,486,777 (GRCm39) S100C probably damaging Het
Tmod3 G A 9: 75,418,488 (GRCm39) P183S probably damaging Het
Trappc10 G T 10: 78,052,994 (GRCm39) F260L possibly damaging Het
Trim16 A T 11: 62,727,638 (GRCm39) Y233F probably benign Het
Trmt112 T C 19: 6,888,121 (GRCm39) V91A probably benign Het
Ttc3 A G 16: 94,230,218 (GRCm39) E450G probably benign Het
Ttk A G 9: 83,745,594 (GRCm39) D647G probably damaging Het
Ubash3b A G 9: 40,948,755 (GRCm39) C187R possibly damaging Het
Vmn1r29 T A 6: 58,285,052 (GRCm39) Y257* probably null Het
Vmn1r33 T C 6: 66,589,089 (GRCm39) N155S probably benign Het
Vmn2r28 T A 7: 5,489,463 (GRCm39) I459L probably benign Het
Vps16 A G 2: 130,281,372 (GRCm39) S235G probably benign Het
Vwde T C 6: 13,192,641 (GRCm39) I421V possibly damaging Het
Xiap T C X: 41,183,342 (GRCm39) F23L probably benign Het
Xkr7 A G 2: 152,896,300 (GRCm39) T385A probably benign Het
Zbtb11 A G 16: 55,826,428 (GRCm39) Y819C probably damaging Het
Zfp112 A G 7: 23,825,909 (GRCm39) T624A probably damaging Het
Zfp592 A G 7: 80,674,095 (GRCm39) D353G probably damaging Het
Zfp62 T A 11: 49,106,556 (GRCm39) S216T probably damaging Het
Zfp677 A T 17: 21,618,056 (GRCm39) H371L probably damaging Het
Zfp780b T C 7: 27,662,873 (GRCm39) K561E possibly damaging Het
Zfp936 G A 7: 42,836,681 (GRCm39) D31N probably damaging Het
Znfx1 T C 2: 166,881,746 (GRCm39) Y217C probably damaging Het
Zpbp C T 11: 11,365,248 (GRCm39) E200K probably benign Het
Other mutations in Cage1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Cage1 APN 13 38,206,969 (GRCm39) nonsense probably null
IGL01736:Cage1 APN 13 38,206,789 (GRCm39) missense possibly damaging 0.93
IGL02149:Cage1 APN 13 38,206,505 (GRCm39) missense probably damaging 1.00
IGL02267:Cage1 APN 13 38,207,233 (GRCm39) missense probably damaging 1.00
IGL03030:Cage1 APN 13 38,212,123 (GRCm39) missense probably benign
IGL03216:Cage1 APN 13 38,190,153 (GRCm39) splice site probably benign
R0487:Cage1 UTSW 13 38,209,334 (GRCm39) missense probably benign 0.00
R0606:Cage1 UTSW 13 38,200,470 (GRCm39) splice site probably benign
R1015:Cage1 UTSW 13 38,200,451 (GRCm39) missense possibly damaging 0.96
R1170:Cage1 UTSW 13 38,206,856 (GRCm39) missense probably damaging 1.00
R1400:Cage1 UTSW 13 38,216,400 (GRCm39) missense possibly damaging 0.86
R1721:Cage1 UTSW 13 38,207,309 (GRCm39) nonsense probably null
R2057:Cage1 UTSW 13 38,207,356 (GRCm39) missense probably benign 0.04
R2058:Cage1 UTSW 13 38,207,356 (GRCm39) missense probably benign 0.04
R2059:Cage1 UTSW 13 38,207,356 (GRCm39) missense probably benign 0.04
R2197:Cage1 UTSW 13 38,207,029 (GRCm39) missense probably damaging 1.00
R3757:Cage1 UTSW 13 38,209,705 (GRCm39) missense possibly damaging 0.71
R3758:Cage1 UTSW 13 38,209,705 (GRCm39) missense possibly damaging 0.71
R4041:Cage1 UTSW 13 38,203,153 (GRCm39) missense possibly damaging 0.96
R4370:Cage1 UTSW 13 38,209,626 (GRCm39) missense probably damaging 1.00
R4401:Cage1 UTSW 13 38,207,078 (GRCm39) missense probably damaging 1.00
R4402:Cage1 UTSW 13 38,207,078 (GRCm39) missense probably damaging 1.00
R4403:Cage1 UTSW 13 38,207,078 (GRCm39) missense probably damaging 1.00
R4490:Cage1 UTSW 13 38,207,393 (GRCm39) missense possibly damaging 0.86
R4621:Cage1 UTSW 13 38,209,477 (GRCm39) missense possibly damaging 0.85
R4921:Cage1 UTSW 13 38,203,184 (GRCm39) missense probably benign 0.33
R4950:Cage1 UTSW 13 38,207,302 (GRCm39) missense possibly damaging 0.55
R4953:Cage1 UTSW 13 38,207,406 (GRCm39) missense possibly damaging 0.51
R5808:Cage1 UTSW 13 38,206,301 (GRCm39) unclassified probably benign
R5845:Cage1 UTSW 13 38,199,682 (GRCm39) missense probably damaging 0.96
R6278:Cage1 UTSW 13 38,200,395 (GRCm39) missense possibly damaging 0.53
R6503:Cage1 UTSW 13 38,209,425 (GRCm39) missense possibly damaging 0.73
R6882:Cage1 UTSW 13 38,206,534 (GRCm39) missense probably damaging 1.00
R7146:Cage1 UTSW 13 38,207,025 (GRCm39) missense probably benign 0.03
R7192:Cage1 UTSW 13 38,203,220 (GRCm39) missense probably benign
R7529:Cage1 UTSW 13 38,209,731 (GRCm39) missense possibly damaging 0.71
R7580:Cage1 UTSW 13 38,206,700 (GRCm39) missense possibly damaging 0.90
R7646:Cage1 UTSW 13 38,206,823 (GRCm39) missense probably damaging 1.00
R7837:Cage1 UTSW 13 38,206,381 (GRCm39) missense not run
R8355:Cage1 UTSW 13 38,203,225 (GRCm39) missense probably damaging 0.99
R8435:Cage1 UTSW 13 38,203,161 (GRCm39) missense possibly damaging 0.73
R8466:Cage1 UTSW 13 38,206,987 (GRCm39) missense probably damaging 1.00
R9047:Cage1 UTSW 13 38,201,338 (GRCm39) missense possibly damaging 0.85
R9086:Cage1 UTSW 13 38,206,898 (GRCm39) missense probably damaging 1.00
R9146:Cage1 UTSW 13 38,207,005 (GRCm39) missense probably benign 0.16
R9442:Cage1 UTSW 13 38,196,447 (GRCm39) missense possibly damaging 0.72
R9587:Cage1 UTSW 13 38,207,233 (GRCm39) missense probably damaging 1.00
R9608:Cage1 UTSW 13 38,195,371 (GRCm39) missense possibly damaging 0.73
R9612:Cage1 UTSW 13 38,216,351 (GRCm39) missense probably damaging 0.99
R9630:Cage1 UTSW 13 38,206,855 (GRCm39) missense probably damaging 1.00
R9690:Cage1 UTSW 13 38,203,141 (GRCm39) critical splice donor site probably null
R9736:Cage1 UTSW 13 38,207,393 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACAGCACGCCCTGTTATC -3'
(R):5'- ACTCCCATTTCCATGATGAGAG -3'

Sequencing Primer
(F):5'- ACGCCCTGTTATCCTATTTCTAAGAG -3'
(R):5'- TTACTTATTGTCGTCAA -3'
Posted On 2016-06-06