Incidental Mutation 'R5023:Ndufa7'
ID391179
Institutional Source Beutler Lab
Gene Symbol Ndufa7
Ensembl Gene ENSMUSG00000041881
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a)
SynonymsNADH oxidoreductase, 2400007M02Rik, 14.5kDa
MMRRC Submission 042614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R5023 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33824591-33838316 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 33824603 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000048249] [ENSMUST00000048560] [ENSMUST00000087342] [ENSMUST00000166693] [ENSMUST00000172649] [ENSMUST00000173019] [ENSMUST00000173132] [ENSMUST00000173789] [ENSMUST00000173844] [ENSMUST00000173879]
Predicted Effect probably benign
Transcript: ENSMUST00000048249
SMART Domains Protein: ENSMUSP00000039692
Gene: ENSMUSG00000041881

DomainStartEndE-ValueType
Pfam:CI-B14_5a 5 102 2.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048560
SMART Domains Protein: ENSMUSP00000040126
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:KN_motif 32 73 9.1e-24 PFAM
low complexity region 105 125 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
coiled coil region 180 229 N/A INTRINSIC
low complexity region 317 362 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
low complexity region 485 498 N/A INTRINSIC
ANK 606 636 3.46e-4 SMART
ANK 640 674 2.88e2 SMART
ANK 679 708 5.41e-6 SMART
ANK 712 742 2.73e-2 SMART
Blast:ANK 746 775 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000087342
SMART Domains Protein: ENSMUSP00000110013
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166693
SMART Domains Protein: ENSMUSP00000133642
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172649
SMART Domains Protein: ENSMUSP00000133760
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
coiled coil region 8 41 N/A INTRINSIC
low complexity region 129 174 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
ANK 418 448 3.46e-4 SMART
ANK 452 486 2.88e2 SMART
ANK 491 520 5.41e-6 SMART
ANK 524 554 2.73e-2 SMART
Blast:ANK 558 587 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173019
SMART Domains Protein: ENSMUSP00000134615
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173649
Predicted Effect probably benign
Transcript: ENSMUST00000173789
SMART Domains Protein: ENSMUSP00000133625
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
ANK 22 56 2.88e2 SMART
ANK 61 90 5.41e-6 SMART
ANK 94 124 2.73e-2 SMART
Blast:ANK 128 157 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173807
Predicted Effect probably benign
Transcript: ENSMUST00000173844
SMART Domains Protein: ENSMUSP00000133357
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 69 3.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173879
SMART Domains Protein: ENSMUSP00000134240
Gene: ENSMUSG00000067288

DomainStartEndE-ValueType
Pfam:Ribosomal_S28e 1 56 2.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174498
Predicted Effect probably benign
Transcript: ENSMUST00000174608
SMART Domains Protein: ENSMUSP00000134656
Gene: ENSMUSG00000042099

DomainStartEndE-ValueType
SCOP:d1bd8__ 2 47 9e-5 SMART
PDB:4HBD|A 8 48 1e-6 PDB
Blast:ANK 23 52 3e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174847
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (127/129)
MGI Phenotype FUNCTION: This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. Complex I has been biochemically separated into four fractions. The bovine ortholog of this protein has been reported to be part of the I-lambda fraction, which forms the extrinsic globular domain. In humans, deficiencies in complex I are associated with myopathies, encephalomyopathies, and neurodegenerative disorders. Pseudogenes of this gene are located on chromosomes 7 and 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abca8b A G 11: 109,974,988 probably null Het
Adam1b C T 5: 121,501,159 V608M probably damaging Het
Ank2 A G 3: 126,941,871 probably benign Het
Ankrd17 A C 5: 90,282,868 L1019R probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Best3 G A 10: 116,988,742 V38I probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Cage1 G T 13: 38,011,411 S778* probably null Het
Capn7 T A 14: 31,352,426 V262E probably damaging Het
Ccdc190 A G 1: 169,933,087 R95G probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh18 G A 15: 23,259,666 S194N probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Ctsw T A 19: 5,466,049 D237V probably damaging Het
Cyp2c68 G A 19: 39,712,507 T289I probably benign Het
Cyp4f39 A G 17: 32,481,104 Y133C probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dnah7a C A 1: 53,647,248 E248* probably null Het
Eef2kmt T A 16: 5,247,599 D248V probably damaging Het
Ewsr1 T C 11: 5,088,054 T113A possibly damaging Het
Fbxo4 A G 15: 3,977,756 probably null Het
Fbxo43 A T 15: 36,162,929 M44K probably benign Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fgf5 C A 5: 98,262,015 A141E probably damaging Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Glp2r T C 11: 67,741,032 T121A possibly damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5155 A T 7: 17,902,706 D236V probably damaging Het
Gm7030 A G 17: 36,109,415 probably benign Het
Gnb2 G A 5: 137,529,940 probably null Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpx5 C T 13: 21,288,745 V140I probably damaging Het
Gtpbp1 A T 15: 79,719,221 Q637L possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hhat A T 1: 192,727,339 L138Q probably damaging Het
Hipk1 G T 3: 103,777,507 T264N probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Hook3 TAGAG TAG 8: 26,032,019 probably null Het
Ifi204 G A 1: 173,751,740 T513I possibly damaging Het
Ino80b G T 6: 83,125,042 S26R probably damaging Het
Ints9 T A 14: 64,980,228 L68H probably damaging Het
Isx C T 8: 74,892,714 T178I probably benign Het
Kel A G 6: 41,688,111 L255P probably damaging Het
Klf11 T A 12: 24,655,359 S271T probably benign Het
Klhl20 A C 1: 161,109,220 probably null Het
Lama2 G A 10: 27,190,504 T1127I probably damaging Het
Larp1b T A 3: 41,033,985 N81K possibly damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Map3k20 T A 2: 72,402,345 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Mybpc1 T G 10: 88,543,774 D635A probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nme4 G A 17: 26,093,668 T129I probably benign Het
Npffr2 A T 5: 89,582,687 T159S probably benign Het
Nup153 A T 13: 46,681,109 probably benign Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr616 A C 7: 103,565,171 M36R possibly damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcca A G 14: 122,790,398 N73D probably damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Pkhd1l1 G A 15: 44,582,227 M3768I probably benign Het
Ppa2 A G 3: 133,370,434 M275V probably benign Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Ptprv A T 1: 135,124,506 noncoding transcript Het
Rad17 A T 13: 100,645,063 H75Q possibly damaging Het
Rbm44 T C 1: 91,169,098 probably null Het
Rbpj C T 5: 53,649,415 R201W probably damaging Het
Rbpjl C A 2: 164,410,289 L215I probably damaging Het
Ror1 A G 4: 100,425,932 E398G probably benign Het
Scamp3 T A 3: 89,182,293 probably benign Het
Selenot CATGTATG CATGTATGTATG 3: 58,588,453 probably null Het
Siglec15 A G 18: 78,048,675 C104R probably damaging Het
Sis T C 3: 72,934,122 I787V probably benign Het
Slc17a8 T C 10: 89,576,560 D521G probably benign Het
Slc7a10 T A 7: 35,197,355 M172K possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Smg8 A C 11: 87,086,137 V206G probably damaging Het
Smg9 A G 7: 24,405,872 K137R possibly damaging Het
Srrm2 C A 17: 23,819,317 probably benign Het
Sult2a2 T A 7: 13,734,860 Y84N possibly damaging Het
Syngr2 A T 11: 117,812,510 I34F probably benign Het
Tank G A 2: 61,578,635 probably benign Het
Tead4 T C 6: 128,294,171 probably benign Het
Tex36 A T 7: 133,595,290 C33S probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tmem240 T A 4: 155,739,674 L92Q probably damaging Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tmod3 G A 9: 75,511,206 P183S probably damaging Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim16 A T 11: 62,836,812 Y233F probably benign Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttc3 A G 16: 94,429,359 E450G probably benign Het
Ttk A G 9: 83,863,541 D647G probably damaging Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Vmn1r29 T A 6: 58,308,067 Y257* probably null Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zbtb11 A G 16: 56,006,065 Y819C probably damaging Het
Zfp112 A G 7: 24,126,484 T624A probably damaging Het
Zfp592 A G 7: 81,024,347 D353G probably damaging Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Zfp677 A T 17: 21,397,794 H371L probably damaging Het
Zfp780b T C 7: 27,963,448 K561E possibly damaging Het
Zfp936 G A 7: 43,187,257 D31N probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Zpbp C T 11: 11,415,248 E200K probably benign Het
Other mutations in Ndufa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01715:Ndufa7 APN 17 33838148 missense probably benign
IGL01765:Ndufa7 APN 17 33829812 nonsense probably null
IGL02902:Ndufa7 APN 17 33829658 splice site probably benign
R4799:Ndufa7 UTSW 17 33838213 utr 3 prime probably benign
R7302:Ndufa7 UTSW 17 33829713 missense probably benign 0.02
R7459:Ndufa7 UTSW 17 33838166 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGGTTTCTAAACACCCGCAG -3'
(R):5'- TGGAGTCACAAATTCAGGGATCC -3'

Sequencing Primer
(F):5'- AGTCGCCTCACCCTAGC -3'
(R):5'- GGGATCCTGGATTATCCACTGAAC -3'
Posted On2016-06-06