Incidental Mutation 'R5024:Or14c39'
ID 391231
Institutional Source Beutler Lab
Gene Symbol Or14c39
Ensembl Gene ENSMUSG00000060688
Gene Name olfactory receptor family 14 subfamily C member 39
Synonyms Olfr292, MOR220-2, GA_x6K02T2NHDJ-9425121-9424195
MMRRC Submission 042615-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5024 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 86337549-86344592 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86344089 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 142 (M142L)
Ref Sequence ENSEMBL: ENSMUSP00000079060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080165]
AlphaFold F8VQ84
Predicted Effect probably benign
Transcript: ENSMUST00000080165
AA Change: M142L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079060
Gene: ENSMUSG00000060688
AA Change: M142L

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 2.6e-48 PFAM
Pfam:7tm_1 39 288 2.7e-22 PFAM
Meta Mutation Damage Score 0.3957 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,248,959 (GRCm39) N575S probably damaging Het
Akap6 C T 12: 53,189,345 (GRCm39) T2253M probably benign Het
Arhgef37 A C 18: 61,639,511 (GRCm39) N289K probably damaging Het
Atad2b A C 12: 4,987,534 (GRCm39) T121P probably benign Het
Atp4a A C 7: 30,415,289 (GRCm39) D303A possibly damaging Het
Calu A T 6: 29,374,518 (GRCm39) probably benign Het
Ccdc141 A C 2: 76,885,047 (GRCm39) N531K probably benign Het
Ccdc146 T C 5: 21,604,612 (GRCm39) probably null Het
Cd207 G A 6: 83,651,301 (GRCm39) T218I probably damaging Het
Cd2ap A C 17: 43,116,236 (GRCm39) probably null Het
Ceacam23 A G 7: 17,644,607 (GRCm39) I575V probably benign Het
Clip3 G A 7: 29,991,644 (GRCm39) probably benign Het
Clstn1 G A 4: 149,719,751 (GRCm39) R432H possibly damaging Het
Csmd2 A G 4: 128,215,141 (GRCm39) Y521C possibly damaging Het
Dnah8 A T 17: 30,955,070 (GRCm39) E2033V probably damaging Het
Eng T G 2: 32,563,404 (GRCm39) V319G probably benign Het
Erp44 C T 4: 48,241,296 (GRCm39) W57* probably null Het
Etv1 T A 12: 38,904,233 (GRCm39) probably null Het
Eva1c T C 16: 90,673,081 (GRCm39) probably null Het
Fam221b T A 4: 43,659,674 (GRCm39) N482I probably damaging Het
Fam83h T C 15: 75,876,991 (GRCm39) H202R probably damaging Het
Fbxw13 T C 9: 109,008,403 (GRCm39) T449A probably benign Het
Fbxw25 A T 9: 109,492,442 (GRCm39) probably null Het
Frmd3 T A 4: 74,016,381 (GRCm39) S99T probably benign Het
Gm5174 G T 10: 86,492,451 (GRCm39) noncoding transcript Het
Gm815 C T 19: 26,865,175 (GRCm39) Q49* probably null Het
H2-DMa A T 17: 34,357,461 (GRCm39) I245F possibly damaging Het
Herc1 A T 9: 66,377,608 (GRCm39) K3458M possibly damaging Het
Hirip3 A G 7: 126,463,661 (GRCm39) probably null Het
Hjurp A T 1: 88,202,772 (GRCm39) Y71N possibly damaging Het
Hmcn1 T A 1: 150,556,439 (GRCm39) E2449V possibly damaging Het
Igll1 G T 16: 16,681,657 (GRCm39) H33N probably benign Het
Il6 T C 5: 30,224,512 (GRCm39) L184P probably damaging Het
Impg2 T A 16: 56,080,463 (GRCm39) S756T probably damaging Het
Insyn2a A G 7: 134,520,207 (GRCm39) S108P probably damaging Het
Kank4 T G 4: 98,673,898 (GRCm39) D5A probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kcns2 A T 15: 34,839,683 (GRCm39) T349S probably benign Het
Keap1 A G 9: 21,148,522 (GRCm39) Y162H probably damaging Het
Kif9 T C 9: 110,312,161 (GRCm39) F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,326,184 (GRCm39) probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lpar6 A G 14: 73,476,809 (GRCm39) T257A probably damaging Het
Lpin1 A T 12: 16,604,007 (GRCm39) L608Q probably benign Het
Lyst T C 13: 13,808,989 (GRCm39) S220P probably benign Het
M1ap A G 6: 83,005,339 (GRCm39) probably benign Het
Mbd6 C T 10: 127,122,310 (GRCm39) V173I probably benign Het
Myo5b A T 18: 74,849,105 (GRCm39) T1115S possibly damaging Het
Mysm1 C A 4: 94,839,253 (GRCm39) V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 (GRCm38) noncoding transcript Het
Odad2 T C 18: 7,088,555 (GRCm39) M1005V probably benign Het
Or2ak5 T A 11: 58,611,776 (GRCm39) I33F probably benign Het
Or5al6 G T 2: 85,976,877 (GRCm39) A67E probably damaging Het
Or8j3c C T 2: 86,253,805 (GRCm39) G72S possibly damaging Het
Otud6b T A 4: 14,826,293 (GRCm39) Q34L probably damaging Het
Parp11 C T 6: 127,448,599 (GRCm39) T72I probably damaging Het
Pbx1 T A 1: 168,011,158 (GRCm39) D343V possibly damaging Het
Phf11 T C 14: 59,495,932 (GRCm39) probably null Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Pramel15 C A 4: 144,099,878 (GRCm39) E296* probably null Het
Ranbp9 A T 13: 43,588,331 (GRCm39) I67N probably damaging Het
Rasgrp4 A G 7: 28,847,832 (GRCm39) E414G probably damaging Het
Rbbp5 A G 1: 132,418,226 (GRCm39) H15R possibly damaging Het
Scd2 A G 19: 44,289,710 (GRCm39) Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 (GRCm39) G170S probably damaging Het
Sh3bp4 G T 1: 89,073,317 (GRCm39) G722C probably damaging Het
Shmt1 A T 11: 60,688,305 (GRCm39) probably benign Het
Slc12a1 A G 2: 125,008,057 (GRCm39) I206V probably benign Het
Slc26a3 A G 12: 31,503,907 (GRCm39) D304G probably benign Het
Slc26a7 T A 4: 14,532,572 (GRCm39) D434V possibly damaging Het
Slc6a16 G T 7: 44,909,390 (GRCm39) M185I probably benign Het
Stat4 A G 1: 52,121,729 (GRCm39) I363V possibly damaging Het
Tgfb1i1 G T 7: 127,847,389 (GRCm39) M1I probably null Het
Thoc2l A G 5: 104,670,124 (GRCm39) K1549E possibly damaging Het
Tmem225 T C 9: 40,060,639 (GRCm39) V66A probably benign Het
Tmtc4 T C 14: 123,178,714 (GRCm39) probably null Het
Trpc4 T A 3: 54,102,217 (GRCm39) N38K probably benign Het
Ttll12 A T 15: 83,471,314 (GRCm39) Y218N probably damaging Het
Ttn A T 2: 76,778,769 (GRCm39) probably null Het
Tulp1 A C 17: 28,570,969 (GRCm39) Y178* probably null Het
Vmn2r58 A G 7: 41,513,746 (GRCm39) V299A probably damaging Het
Washc4 C A 10: 83,419,200 (GRCm39) Q911K possibly damaging Het
Wdr3 T C 3: 100,062,252 (GRCm39) D221G probably benign Het
Zan A T 5: 137,460,155 (GRCm39) C1245* probably null Het
Zfyve9 A C 4: 108,548,866 (GRCm39) S773A probably benign Het
Other mutations in Or14c39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Or14c39 APN 7 86,344,501 (GRCm39) missense probably benign 0.10
IGL01751:Or14c39 APN 7 86,343,997 (GRCm39) missense probably benign
IGL02417:Or14c39 APN 7 86,344,027 (GRCm39) missense probably damaging 1.00
IGL02534:Or14c39 APN 7 86,343,939 (GRCm39) missense probably benign 0.17
IGL02830:Or14c39 APN 7 86,344,382 (GRCm39) missense probably damaging 1.00
R0281:Or14c39 UTSW 7 86,344,068 (GRCm39) missense probably benign 0.00
R0423:Or14c39 UTSW 7 86,344,434 (GRCm39) missense possibly damaging 0.95
R0555:Or14c39 UTSW 7 86,344,516 (GRCm39) missense probably damaging 1.00
R0609:Or14c39 UTSW 7 86,344,084 (GRCm39) missense possibly damaging 0.85
R0662:Or14c39 UTSW 7 86,343,838 (GRCm39) missense possibly damaging 0.88
R1710:Or14c39 UTSW 7 86,344,318 (GRCm39) missense probably benign 0.00
R2144:Or14c39 UTSW 7 86,344,488 (GRCm39) missense probably damaging 0.98
R4400:Or14c39 UTSW 7 86,343,798 (GRCm39) missense probably benign 0.10
R4615:Or14c39 UTSW 7 86,343,936 (GRCm39) missense probably damaging 1.00
R4762:Or14c39 UTSW 7 86,344,329 (GRCm39) missense probably benign 0.01
R4785:Or14c39 UTSW 7 86,343,736 (GRCm39) missense probably damaging 1.00
R4823:Or14c39 UTSW 7 86,343,796 (GRCm39) missense probably damaging 0.99
R4908:Or14c39 UTSW 7 86,344,395 (GRCm39) missense probably benign 0.00
R4983:Or14c39 UTSW 7 86,343,687 (GRCm39) missense probably benign 0.01
R5010:Or14c39 UTSW 7 86,343,793 (GRCm39) missense possibly damaging 0.95
R5157:Or14c39 UTSW 7 86,344,440 (GRCm39) missense probably benign 0.19
R5627:Or14c39 UTSW 7 86,344,347 (GRCm39) missense possibly damaging 0.93
R6327:Or14c39 UTSW 7 86,343,760 (GRCm39) missense probably benign 0.09
R6375:Or14c39 UTSW 7 86,344,267 (GRCm39) missense probably benign 0.01
R6775:Or14c39 UTSW 7 86,344,357 (GRCm39) missense probably benign 0.02
R7257:Or14c39 UTSW 7 86,344,012 (GRCm39) missense probably damaging 0.99
R7383:Or14c39 UTSW 7 86,343,960 (GRCm39) missense probably damaging 0.97
R8475:Or14c39 UTSW 7 86,344,361 (GRCm39) missense probably benign 0.21
R9034:Or14c39 UTSW 7 86,343,969 (GRCm39) missense probably benign 0.41
R9134:Or14c39 UTSW 7 86,344,588 (GRCm39) nonsense probably null
R9588:Or14c39 UTSW 7 86,343,948 (GRCm39) missense probably damaging 1.00
R9777:Or14c39 UTSW 7 86,343,988 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATCTGTTACTGTGCCCAATGC -3'
(R):5'- ACTGAGACCAATGGCAGAC -3'

Sequencing Primer
(F):5'- GTGCCCAATGCTTGTATCAAC -3'
(R):5'- TGGCAGACAGAAGAAGTAATAGTTTG -3'
Posted On 2016-06-06