Incidental Mutation 'R5024:Kif9'
ID 391243
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Name kinesin family member 9
Synonyms
MMRRC Submission 042615-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R5024 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 110306062-110354242 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110312161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 10 (F10L)
Ref Sequence ENSEMBL: ENSMUSP00000082016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043] [ENSMUST00000198858]
AlphaFold Q9WV04
Predicted Effect possibly damaging
Transcript: ENSMUST00000061155
AA Change: F10L

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: F10L

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084952
AA Change: F10L

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: F10L

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197248
AA Change: F10L

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: F10L

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198043
AA Change: F10L

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489
AA Change: F10L

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198858
SMART Domains Protein: ENSMUSP00000142888
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 9 144 6.7e-7 SMART
Meta Mutation Damage Score 0.2841 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,248,959 (GRCm39) N575S probably damaging Het
Akap6 C T 12: 53,189,345 (GRCm39) T2253M probably benign Het
Arhgef37 A C 18: 61,639,511 (GRCm39) N289K probably damaging Het
Atad2b A C 12: 4,987,534 (GRCm39) T121P probably benign Het
Atp4a A C 7: 30,415,289 (GRCm39) D303A possibly damaging Het
Calu A T 6: 29,374,518 (GRCm39) probably benign Het
Ccdc141 A C 2: 76,885,047 (GRCm39) N531K probably benign Het
Ccdc146 T C 5: 21,604,612 (GRCm39) probably null Het
Cd207 G A 6: 83,651,301 (GRCm39) T218I probably damaging Het
Cd2ap A C 17: 43,116,236 (GRCm39) probably null Het
Ceacam23 A G 7: 17,644,607 (GRCm39) I575V probably benign Het
Clip3 G A 7: 29,991,644 (GRCm39) probably benign Het
Clstn1 G A 4: 149,719,751 (GRCm39) R432H possibly damaging Het
Csmd2 A G 4: 128,215,141 (GRCm39) Y521C possibly damaging Het
Dnah8 A T 17: 30,955,070 (GRCm39) E2033V probably damaging Het
Eng T G 2: 32,563,404 (GRCm39) V319G probably benign Het
Erp44 C T 4: 48,241,296 (GRCm39) W57* probably null Het
Etv1 T A 12: 38,904,233 (GRCm39) probably null Het
Eva1c T C 16: 90,673,081 (GRCm39) probably null Het
Fam221b T A 4: 43,659,674 (GRCm39) N482I probably damaging Het
Fam83h T C 15: 75,876,991 (GRCm39) H202R probably damaging Het
Fbxw13 T C 9: 109,008,403 (GRCm39) T449A probably benign Het
Fbxw25 A T 9: 109,492,442 (GRCm39) probably null Het
Frmd3 T A 4: 74,016,381 (GRCm39) S99T probably benign Het
Gm5174 G T 10: 86,492,451 (GRCm39) noncoding transcript Het
Gm815 C T 19: 26,865,175 (GRCm39) Q49* probably null Het
H2-DMa A T 17: 34,357,461 (GRCm39) I245F possibly damaging Het
Herc1 A T 9: 66,377,608 (GRCm39) K3458M possibly damaging Het
Hirip3 A G 7: 126,463,661 (GRCm39) probably null Het
Hjurp A T 1: 88,202,772 (GRCm39) Y71N possibly damaging Het
Hmcn1 T A 1: 150,556,439 (GRCm39) E2449V possibly damaging Het
Igll1 G T 16: 16,681,657 (GRCm39) H33N probably benign Het
Il6 T C 5: 30,224,512 (GRCm39) L184P probably damaging Het
Impg2 T A 16: 56,080,463 (GRCm39) S756T probably damaging Het
Insyn2a A G 7: 134,520,207 (GRCm39) S108P probably damaging Het
Kank4 T G 4: 98,673,898 (GRCm39) D5A probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kcns2 A T 15: 34,839,683 (GRCm39) T349S probably benign Het
Keap1 A G 9: 21,148,522 (GRCm39) Y162H probably damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,326,184 (GRCm39) probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lpar6 A G 14: 73,476,809 (GRCm39) T257A probably damaging Het
Lpin1 A T 12: 16,604,007 (GRCm39) L608Q probably benign Het
Lyst T C 13: 13,808,989 (GRCm39) S220P probably benign Het
M1ap A G 6: 83,005,339 (GRCm39) probably benign Het
Mbd6 C T 10: 127,122,310 (GRCm39) V173I probably benign Het
Myo5b A T 18: 74,849,105 (GRCm39) T1115S possibly damaging Het
Mysm1 C A 4: 94,839,253 (GRCm39) V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 (GRCm38) noncoding transcript Het
Odad2 T C 18: 7,088,555 (GRCm39) M1005V probably benign Het
Or14c39 A T 7: 86,344,089 (GRCm39) M142L probably benign Het
Or2ak5 T A 11: 58,611,776 (GRCm39) I33F probably benign Het
Or5al6 G T 2: 85,976,877 (GRCm39) A67E probably damaging Het
Or8j3c C T 2: 86,253,805 (GRCm39) G72S possibly damaging Het
Otud6b T A 4: 14,826,293 (GRCm39) Q34L probably damaging Het
Parp11 C T 6: 127,448,599 (GRCm39) T72I probably damaging Het
Pbx1 T A 1: 168,011,158 (GRCm39) D343V possibly damaging Het
Phf11 T C 14: 59,495,932 (GRCm39) probably null Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Pramel15 C A 4: 144,099,878 (GRCm39) E296* probably null Het
Ranbp9 A T 13: 43,588,331 (GRCm39) I67N probably damaging Het
Rasgrp4 A G 7: 28,847,832 (GRCm39) E414G probably damaging Het
Rbbp5 A G 1: 132,418,226 (GRCm39) H15R possibly damaging Het
Scd2 A G 19: 44,289,710 (GRCm39) Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 (GRCm39) G170S probably damaging Het
Sh3bp4 G T 1: 89,073,317 (GRCm39) G722C probably damaging Het
Shmt1 A T 11: 60,688,305 (GRCm39) probably benign Het
Slc12a1 A G 2: 125,008,057 (GRCm39) I206V probably benign Het
Slc26a3 A G 12: 31,503,907 (GRCm39) D304G probably benign Het
Slc26a7 T A 4: 14,532,572 (GRCm39) D434V possibly damaging Het
Slc6a16 G T 7: 44,909,390 (GRCm39) M185I probably benign Het
Stat4 A G 1: 52,121,729 (GRCm39) I363V possibly damaging Het
Tgfb1i1 G T 7: 127,847,389 (GRCm39) M1I probably null Het
Thoc2l A G 5: 104,670,124 (GRCm39) K1549E possibly damaging Het
Tmem225 T C 9: 40,060,639 (GRCm39) V66A probably benign Het
Tmtc4 T C 14: 123,178,714 (GRCm39) probably null Het
Trpc4 T A 3: 54,102,217 (GRCm39) N38K probably benign Het
Ttll12 A T 15: 83,471,314 (GRCm39) Y218N probably damaging Het
Ttn A T 2: 76,778,769 (GRCm39) probably null Het
Tulp1 A C 17: 28,570,969 (GRCm39) Y178* probably null Het
Vmn2r58 A G 7: 41,513,746 (GRCm39) V299A probably damaging Het
Washc4 C A 10: 83,419,200 (GRCm39) Q911K possibly damaging Het
Wdr3 T C 3: 100,062,252 (GRCm39) D221G probably benign Het
Zan A T 5: 137,460,155 (GRCm39) C1245* probably null Het
Zfyve9 A C 4: 108,548,866 (GRCm39) S773A probably benign Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110,314,138 (GRCm39) missense probably benign 0.03
IGL02273:Kif9 APN 9 110,339,538 (GRCm39) missense probably damaging 0.99
IGL02818:Kif9 APN 9 110,314,217 (GRCm39) missense probably damaging 1.00
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0137:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably damaging 1.00
R0594:Kif9 UTSW 9 110,340,408 (GRCm39) missense probably benign 0.22
R1503:Kif9 UTSW 9 110,339,506 (GRCm39) missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110,319,034 (GRCm39) missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110,346,701 (GRCm39) missense probably benign 0.34
R1856:Kif9 UTSW 9 110,346,787 (GRCm39) missense probably null 1.00
R2076:Kif9 UTSW 9 110,314,100 (GRCm39) splice site probably null
R3407:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R4247:Kif9 UTSW 9 110,325,027 (GRCm39) critical splice donor site probably null
R4487:Kif9 UTSW 9 110,323,552 (GRCm39) missense probably null 1.00
R4515:Kif9 UTSW 9 110,318,935 (GRCm39) missense probably benign 0.38
R4880:Kif9 UTSW 9 110,330,703 (GRCm39) missense probably damaging 0.98
R5093:Kif9 UTSW 9 110,318,965 (GRCm39) missense probably damaging 1.00
R5181:Kif9 UTSW 9 110,350,336 (GRCm39) missense probably damaging 1.00
R5362:Kif9 UTSW 9 110,319,012 (GRCm39) missense probably damaging 0.99
R5379:Kif9 UTSW 9 110,350,371 (GRCm39) missense probably benign 0.00
R5628:Kif9 UTSW 9 110,343,621 (GRCm39) nonsense probably null
R5653:Kif9 UTSW 9 110,353,999 (GRCm39) missense probably damaging 1.00
R5698:Kif9 UTSW 9 110,339,532 (GRCm39) missense probably benign
R5758:Kif9 UTSW 9 110,318,947 (GRCm39) missense probably damaging 1.00
R5986:Kif9 UTSW 9 110,319,094 (GRCm39) missense probably benign 0.05
R6103:Kif9 UTSW 9 110,318,917 (GRCm39) missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110,317,612 (GRCm39) missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110,346,902 (GRCm39) splice site probably null
R6991:Kif9 UTSW 9 110,323,690 (GRCm39) missense probably damaging 1.00
R7113:Kif9 UTSW 9 110,335,732 (GRCm39) missense probably damaging 1.00
R7459:Kif9 UTSW 9 110,348,109 (GRCm39) missense probably damaging 1.00
R7593:Kif9 UTSW 9 110,350,421 (GRCm39) missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110,343,682 (GRCm39) missense not run
R8050:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R8370:Kif9 UTSW 9 110,317,681 (GRCm39) missense probably damaging 1.00
R8549:Kif9 UTSW 9 110,343,487 (GRCm39) splice site probably null
R8751:Kif9 UTSW 9 110,330,724 (GRCm39) missense probably benign 0.03
R8830:Kif9 UTSW 9 110,353,998 (GRCm39) missense probably damaging 1.00
R9489:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9519:Kif9 UTSW 9 110,350,344 (GRCm39) missense probably damaging 0.98
R9605:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9776:Kif9 UTSW 9 110,350,398 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTACTTACAGGGCAGGGAC -3'
(R):5'- GGAGTTGATGGACTGACTCTAGAG -3'

Sequencing Primer
(F):5'- TGAAGCTGGCCTTGAACTC -3'
(R):5'- GGACTGACTCTAGAGTTTACATGAAC -3'
Posted On 2016-06-06