Incidental Mutation 'R5024:Atad2b'
ID 391251
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
MMRRC Submission 042615-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5024 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 4937534 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 121 (T121P)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
AlphaFold E9Q166
Predicted Effect probably benign
Transcript: ENSMUST00000045664
AA Change: T121P

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: T121P

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219187
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,171,895 N575S probably damaging Het
Akap6 C T 12: 53,142,562 T2253M probably benign Het
Arhgef37 A C 18: 61,506,440 N289K probably damaging Het
Armc4 T C 18: 7,088,555 M1005V probably benign Het
Atp4a A C 7: 30,715,864 D303A possibly damaging Het
BC005561 A G 5: 104,522,258 K1549E possibly damaging Het
Calu A T 6: 29,374,519 probably benign Het
Ccdc141 A C 2: 77,054,703 N531K probably benign Het
Ccdc146 T C 5: 21,399,614 probably null Het
Cd207 G A 6: 83,674,319 T218I probably damaging Het
Cd2ap A C 17: 42,805,345 probably null Het
Clip3 G A 7: 30,292,219 probably benign Het
Clstn1 G A 4: 149,635,294 R432H possibly damaging Het
Csmd2 A G 4: 128,321,348 Y521C possibly damaging Het
Dnah8 A T 17: 30,736,096 E2033V probably damaging Het
Eng T G 2: 32,673,392 V319G probably benign Het
Erp44 C T 4: 48,241,296 W57* probably null Het
Etv1 T A 12: 38,854,234 probably null Het
Eva1c T C 16: 90,876,193 probably null Het
Fam196a A G 7: 134,918,478 S108P probably damaging Het
Fam221b T A 4: 43,659,674 N482I probably damaging Het
Fam83h T C 15: 76,005,142 H202R probably damaging Het
Fbxw13 T C 9: 109,179,335 T449A probably benign Het
Fbxw25 A T 9: 109,663,374 probably null Het
Frmd3 T A 4: 74,098,144 S99T probably benign Het
Gm5155 A G 7: 17,910,682 I575V probably benign Het
Gm5174 G T 10: 86,656,587 noncoding transcript Het
Gm6904 T C 14: 59,258,483 probably null Het
Gm815 C T 19: 26,887,775 Q49* probably null Het
H2-DMa A T 17: 34,138,487 I245F possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hirip3 A G 7: 126,864,489 probably null Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hmcn1 T A 1: 150,680,688 E2449V possibly damaging Het
Igll1 G T 16: 16,863,793 H33N probably benign Het
Il6 T C 5: 30,019,514 L184P probably damaging Het
Impg2 T A 16: 56,260,100 S756T probably damaging Het
Kank4 T G 4: 98,785,661 D5A probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcns2 A T 15: 34,839,537 T349S probably benign Het
Keap1 A G 9: 21,237,226 Y162H probably damaging Het
Kif9 T C 9: 110,483,093 F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lpar6 A G 14: 73,239,369 T257A probably damaging Het
Lpin1 A T 12: 16,554,006 L608Q probably benign Het
Lyst T C 13: 13,634,404 S220P probably benign Het
M1ap A G 6: 83,028,358 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Myo5b A T 18: 74,716,034 T1115S possibly damaging Het
Mysm1 C A 4: 94,951,016 V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 noncoding transcript Het
Olfr1040 G T 2: 86,146,533 A67E probably damaging Het
Olfr1062 C T 2: 86,423,461 G72S possibly damaging Het
Olfr292 A T 7: 86,694,881 M142L probably benign Het
Olfr318 T A 11: 58,720,950 I33F probably benign Het
Otud6b T A 4: 14,826,293 Q34L probably damaging Het
Parp11 C T 6: 127,471,636 T72I probably damaging Het
Pbx1 T A 1: 168,183,589 D343V possibly damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pramef20 C A 4: 144,373,308 E296* probably null Het
Ranbp9 A T 13: 43,434,855 I67N probably damaging Het
Rasgrp4 A G 7: 29,148,407 E414G probably damaging Het
Rbbp5 A G 1: 132,490,488 H15R possibly damaging Het
Scd2 A G 19: 44,301,271 Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 G170S probably damaging Het
Sh3bp4 G T 1: 89,145,595 G722C probably damaging Het
Shmt1 A T 11: 60,797,479 probably benign Het
Slc12a1 A G 2: 125,166,137 I206V probably benign Het
Slc26a3 A G 12: 31,453,908 D304G probably benign Het
Slc26a7 T A 4: 14,532,572 D434V possibly damaging Het
Slc6a16 G T 7: 45,259,966 M185I probably benign Het
Stat4 A G 1: 52,082,570 I363V possibly damaging Het
Tgfb1i1 G T 7: 128,248,217 M1I probably null Het
Tmem225 T C 9: 40,149,343 V66A probably benign Het
Tmtc4 T C 14: 122,941,302 probably null Het
Trpc4 T A 3: 54,194,796 N38K probably benign Het
Ttll12 A T 15: 83,587,113 Y218N probably damaging Het
Ttn A T 2: 76,948,425 probably null Het
Tulp1 A C 17: 28,351,995 Y178* probably null Het
Vmn2r58 A G 7: 41,864,322 V299A probably damaging Het
Washc4 C A 10: 83,583,336 Q911K possibly damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan A T 5: 137,461,893 C1245* probably null Het
Zfyve9 A C 4: 108,691,669 S773A probably benign Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGTCATGCTCACTCCAGC -3'
(R):5'- AACAATAGTTTCTGGCACATGC -3'

Sequencing Primer
(F):5'- CCTTTGGAAGAACAGTCAGTGCTC -3'
(R):5'- TGGCACATGCTATTTTACATGTC -3'
Posted On 2016-06-06