Incidental Mutation 'R5024:Lpin1'
ID391252
Institutional Source Beutler Lab
Gene Symbol Lpin1
Ensembl Gene ENSMUSG00000020593
Gene Namelipin 1
SynonymsLipin1
MMRRC Submission 042615-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R5024 (G1)
Quality Score193
Status Validated
Chromosome12
Chromosomal Location16535669-16610966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16554006 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 608 (L608Q)
Ref Sequence ENSEMBL: ENSMUSP00000152285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067124] [ENSMUST00000111067] [ENSMUST00000221230] [ENSMUST00000221297] [ENSMUST00000222989]
Predicted Effect probably benign
Transcript: ENSMUST00000067124
AA Change: L608Q

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000070583
Gene: ENSMUSG00000020593
AA Change: L608Q

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 1.1e-48 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:Lipin_mid 498 591 9.4e-36 PFAM
low complexity region 630 642 N/A INTRINSIC
LNS2 708 864 3.42e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111067
AA Change: L608Q

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106696
Gene: ENSMUSG00000020593
AA Change: L608Q

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
LNS2 675 831 3.42e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221230
AA Change: L575Q

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000221297
AA Change: L608Q

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221789
Predicted Effect probably benign
Transcript: ENSMUST00000222989
AA Change: L575Q

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
PHENOTYPE: ENU-induced mutants show transient hindlimb paralysis, demyelination and myelin sheath defects. Spontaneous mutants show neonatal fatty liver and hypertriglyceridemia, runting, male sterility, peripheral neuropathy, and altered hair growth, myelination, adipogenesis and lipid and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,171,895 N575S probably damaging Het
Akap6 C T 12: 53,142,562 T2253M probably benign Het
Arhgef37 A C 18: 61,506,440 N289K probably damaging Het
Armc4 T C 18: 7,088,555 M1005V probably benign Het
Atad2b A C 12: 4,937,534 T121P probably benign Het
Atp4a A C 7: 30,715,864 D303A possibly damaging Het
BC005561 A G 5: 104,522,258 K1549E possibly damaging Het
Calu A T 6: 29,374,519 probably benign Het
Ccdc141 A C 2: 77,054,703 N531K probably benign Het
Ccdc146 T C 5: 21,399,614 probably null Het
Cd207 G A 6: 83,674,319 T218I probably damaging Het
Cd2ap A C 17: 42,805,345 probably null Het
Clip3 G A 7: 30,292,219 probably benign Het
Clstn1 G A 4: 149,635,294 R432H possibly damaging Het
Csmd2 A G 4: 128,321,348 Y521C possibly damaging Het
Dnah8 A T 17: 30,736,096 E2033V probably damaging Het
Eng T G 2: 32,673,392 V319G probably benign Het
Erp44 C T 4: 48,241,296 W57* probably null Het
Etv1 T A 12: 38,854,234 probably null Het
Eva1c T C 16: 90,876,193 probably null Het
Fam196a A G 7: 134,918,478 S108P probably damaging Het
Fam221b T A 4: 43,659,674 N482I probably damaging Het
Fam83h T C 15: 76,005,142 H202R probably damaging Het
Fbxw13 T C 9: 109,179,335 T449A probably benign Het
Fbxw25 A T 9: 109,663,374 probably null Het
Frmd3 T A 4: 74,098,144 S99T probably benign Het
Gm5155 A G 7: 17,910,682 I575V probably benign Het
Gm5174 G T 10: 86,656,587 noncoding transcript Het
Gm6904 T C 14: 59,258,483 probably null Het
Gm815 C T 19: 26,887,775 Q49* probably null Het
H2-DMa A T 17: 34,138,487 I245F possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hirip3 A G 7: 126,864,489 probably null Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hmcn1 T A 1: 150,680,688 E2449V possibly damaging Het
Igll1 G T 16: 16,863,793 H33N probably benign Het
Il6 T C 5: 30,019,514 L184P probably damaging Het
Impg2 T A 16: 56,260,100 S756T probably damaging Het
Kank4 T G 4: 98,785,661 D5A probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcns2 A T 15: 34,839,537 T349S probably benign Het
Keap1 A G 9: 21,237,226 Y162H probably damaging Het
Kif9 T C 9: 110,483,093 F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lpar6 A G 14: 73,239,369 T257A probably damaging Het
Lyst T C 13: 13,634,404 S220P probably benign Het
M1ap A G 6: 83,028,358 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Myo5b A T 18: 74,716,034 T1115S possibly damaging Het
Mysm1 C A 4: 94,951,016 V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 noncoding transcript Het
Olfr1040 G T 2: 86,146,533 A67E probably damaging Het
Olfr1062 C T 2: 86,423,461 G72S possibly damaging Het
Olfr292 A T 7: 86,694,881 M142L probably benign Het
Olfr318 T A 11: 58,720,950 I33F probably benign Het
Otud6b T A 4: 14,826,293 Q34L probably damaging Het
Parp11 C T 6: 127,471,636 T72I probably damaging Het
Pbx1 T A 1: 168,183,589 D343V possibly damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pramef20 C A 4: 144,373,308 E296* probably null Het
Ranbp9 A T 13: 43,434,855 I67N probably damaging Het
Rasgrp4 A G 7: 29,148,407 E414G probably damaging Het
Rbbp5 A G 1: 132,490,488 H15R possibly damaging Het
Scd2 A G 19: 44,301,271 Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 G170S probably damaging Het
Sh3bp4 G T 1: 89,145,595 G722C probably damaging Het
Shmt1 A T 11: 60,797,479 probably benign Het
Slc12a1 A G 2: 125,166,137 I206V probably benign Het
Slc26a3 A G 12: 31,453,908 D304G probably benign Het
Slc26a7 T A 4: 14,532,572 D434V possibly damaging Het
Slc6a16 G T 7: 45,259,966 M185I probably benign Het
Stat4 A G 1: 52,082,570 I363V possibly damaging Het
Tgfb1i1 G T 7: 128,248,217 M1I probably null Het
Tmem225 T C 9: 40,149,343 V66A probably benign Het
Tmtc4 T C 14: 122,941,302 probably null Het
Trpc4 T A 3: 54,194,796 N38K probably benign Het
Ttll12 A T 15: 83,587,113 Y218N probably damaging Het
Ttn A T 2: 76,948,425 probably null Het
Tulp1 A C 17: 28,351,995 Y178* probably null Het
Vmn2r58 A G 7: 41,864,322 V299A probably damaging Het
Washc4 C A 10: 83,583,336 Q911K possibly damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan A T 5: 137,461,893 C1245* probably null Het
Zfyve9 A C 4: 108,691,669 S773A probably benign Het
Other mutations in Lpin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Lpin1 APN 12 16553992 missense probably benign 0.00
IGL00929:Lpin1 APN 12 16573699 missense probably benign 0.05
IGL01485:Lpin1 APN 12 16562357 splice site probably benign
IGL01750:Lpin1 APN 12 16577176 missense probably benign 0.00
IGL01774:Lpin1 APN 12 16558476 missense probably damaging 0.96
IGL02197:Lpin1 APN 12 16558407 critical splice donor site probably null
IGL02244:Lpin1 APN 12 16541769 missense probably damaging 0.99
IGL02272:Lpin1 APN 12 16547600 missense probably damaging 1.00
IGL03366:Lpin1 APN 12 16544677 missense probably damaging 1.00
lipin UTSW 12 16547499 missense probably damaging 1.00
R0044:Lpin1 UTSW 12 16568529 splice site probably benign
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0676:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R1119:Lpin1 UTSW 12 16563721 missense probably damaging 1.00
R1570:Lpin1 UTSW 12 16560998 missense possibly damaging 0.94
R1611:Lpin1 UTSW 12 16577218 missense probably null 0.64
R1646:Lpin1 UTSW 12 16573658 critical splice donor site probably null
R1756:Lpin1 UTSW 12 16538540 missense probably damaging 0.99
R1870:Lpin1 UTSW 12 16541743 missense probably damaging 1.00
R1912:Lpin1 UTSW 12 16546727 missense probably damaging 0.96
R1971:Lpin1 UTSW 12 16580723 missense probably damaging 1.00
R2484:Lpin1 UTSW 12 16547499 missense probably damaging 1.00
R2901:Lpin1 UTSW 12 16553998 missense probably benign
R3195:Lpin1 UTSW 12 16565583 missense possibly damaging 0.91
R3779:Lpin1 UTSW 12 16564568 missense probably damaging 0.96
R3918:Lpin1 UTSW 12 16571189 missense probably benign 0.00
R4532:Lpin1 UTSW 12 16553962 missense probably benign 0.01
R4857:Lpin1 UTSW 12 16563630 missense possibly damaging 0.86
R4882:Lpin1 UTSW 12 16538536 missense probably damaging 1.00
R5084:Lpin1 UTSW 12 16576982 missense probably damaging 1.00
R5108:Lpin1 UTSW 12 16573715 missense probably benign 0.39
R5191:Lpin1 UTSW 12 16580828 missense possibly damaging 0.95
R5377:Lpin1 UTSW 12 16563655 missense probably damaging 1.00
R5587:Lpin1 UTSW 12 16573714 missense probably damaging 1.00
R5659:Lpin1 UTSW 12 16540989 missense probably damaging 1.00
R5924:Lpin1 UTSW 12 16544657 missense possibly damaging 0.91
R6391:Lpin1 UTSW 12 16564553 missense probably benign 0.29
R6746:Lpin1 UTSW 12 16565528 missense probably benign
R6799:Lpin1 UTSW 12 16561044 missense probably damaging 1.00
R6969:Lpin1 UTSW 12 16580861 missense probably damaging 0.99
R7557:Lpin1 UTSW 12 16580792 missense
Predicted Primers PCR Primer
(F):5'- CTGCATATTCTGGCGCAAGG -3'
(R):5'- GTAATGAGGACCTGCCAGAAC -3'

Sequencing Primer
(F):5'- TATTCTGGCGCAAGGAGAAATAAACC -3'
(R):5'- GAGGACCTGCCAGAACAAACATC -3'
Posted On2016-06-06