Incidental Mutation 'R5024:Impg2'
ID 391265
Institutional Source Beutler Lab
Gene Symbol Impg2
Ensembl Gene ENSMUSG00000035270
Gene Name interphotoreceptor matrix proteoglycan 2
Synonyms IPM200, Spacrcan, PG10.2
MMRRC Submission 042615-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R5024 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 56024676-56094119 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 56080463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 756 (S756T)
Ref Sequence ENSEMBL: ENSMUSP00000063648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069936] [ENSMUST00000160116]
AlphaFold Q80XH2
Predicted Effect probably damaging
Transcript: ENSMUST00000069936
AA Change: S756T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063648
Gene: ENSMUSG00000035270
AA Change: S756T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
low complexity region 396 407 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
SEA 895 1018 2.18e-28 SMART
EGF_like 1016 1054 3.57e1 SMART
EGF_like 1056 1096 3.04e1 SMART
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160116
AA Change: S647T

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125135
Gene: ENSMUSG00000035270
AA Change: S647T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
SEA 786 909 2.18e-28 SMART
EGF_like 907 945 3.57e1 SMART
EGF_like 947 987 3.04e1 SMART
transmembrane domain 996 1018 N/A INTRINSIC
Meta Mutation Damage Score 0.0924 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds chondroitin sulfate and hyaluronan and is a proteoglycan. The encoded protein plays a role in the organization of the interphotoreceptor matrix and may promote the growth and maintenance of the light-sensitive photoreceptor outer segment. Defects in this gene are a cause of retinitis pigmentosa type 56 and maculopathy, IMPG2-related.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,248,959 (GRCm39) N575S probably damaging Het
Akap6 C T 12: 53,189,345 (GRCm39) T2253M probably benign Het
Arhgef37 A C 18: 61,639,511 (GRCm39) N289K probably damaging Het
Atad2b A C 12: 4,987,534 (GRCm39) T121P probably benign Het
Atp4a A C 7: 30,415,289 (GRCm39) D303A possibly damaging Het
Calu A T 6: 29,374,518 (GRCm39) probably benign Het
Ccdc141 A C 2: 76,885,047 (GRCm39) N531K probably benign Het
Ccdc146 T C 5: 21,604,612 (GRCm39) probably null Het
Cd207 G A 6: 83,651,301 (GRCm39) T218I probably damaging Het
Cd2ap A C 17: 43,116,236 (GRCm39) probably null Het
Ceacam23 A G 7: 17,644,607 (GRCm39) I575V probably benign Het
Clip3 G A 7: 29,991,644 (GRCm39) probably benign Het
Clstn1 G A 4: 149,719,751 (GRCm39) R432H possibly damaging Het
Csmd2 A G 4: 128,215,141 (GRCm39) Y521C possibly damaging Het
Dnah8 A T 17: 30,955,070 (GRCm39) E2033V probably damaging Het
Eng T G 2: 32,563,404 (GRCm39) V319G probably benign Het
Erp44 C T 4: 48,241,296 (GRCm39) W57* probably null Het
Etv1 T A 12: 38,904,233 (GRCm39) probably null Het
Eva1c T C 16: 90,673,081 (GRCm39) probably null Het
Fam221b T A 4: 43,659,674 (GRCm39) N482I probably damaging Het
Fam83h T C 15: 75,876,991 (GRCm39) H202R probably damaging Het
Fbxw13 T C 9: 109,008,403 (GRCm39) T449A probably benign Het
Fbxw25 A T 9: 109,492,442 (GRCm39) probably null Het
Frmd3 T A 4: 74,016,381 (GRCm39) S99T probably benign Het
Gm5174 G T 10: 86,492,451 (GRCm39) noncoding transcript Het
Gm815 C T 19: 26,865,175 (GRCm39) Q49* probably null Het
H2-DMa A T 17: 34,357,461 (GRCm39) I245F possibly damaging Het
Herc1 A T 9: 66,377,608 (GRCm39) K3458M possibly damaging Het
Hirip3 A G 7: 126,463,661 (GRCm39) probably null Het
Hjurp A T 1: 88,202,772 (GRCm39) Y71N possibly damaging Het
Hmcn1 T A 1: 150,556,439 (GRCm39) E2449V possibly damaging Het
Igll1 G T 16: 16,681,657 (GRCm39) H33N probably benign Het
Il6 T C 5: 30,224,512 (GRCm39) L184P probably damaging Het
Insyn2a A G 7: 134,520,207 (GRCm39) S108P probably damaging Het
Kank4 T G 4: 98,673,898 (GRCm39) D5A probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kcns2 A T 15: 34,839,683 (GRCm39) T349S probably benign Het
Keap1 A G 9: 21,148,522 (GRCm39) Y162H probably damaging Het
Kif9 T C 9: 110,312,161 (GRCm39) F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,326,184 (GRCm39) probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lpar6 A G 14: 73,476,809 (GRCm39) T257A probably damaging Het
Lpin1 A T 12: 16,604,007 (GRCm39) L608Q probably benign Het
Lyst T C 13: 13,808,989 (GRCm39) S220P probably benign Het
M1ap A G 6: 83,005,339 (GRCm39) probably benign Het
Mbd6 C T 10: 127,122,310 (GRCm39) V173I probably benign Het
Myo5b A T 18: 74,849,105 (GRCm39) T1115S possibly damaging Het
Mysm1 C A 4: 94,839,253 (GRCm39) V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 (GRCm38) noncoding transcript Het
Odad2 T C 18: 7,088,555 (GRCm39) M1005V probably benign Het
Or14c39 A T 7: 86,344,089 (GRCm39) M142L probably benign Het
Or2ak5 T A 11: 58,611,776 (GRCm39) I33F probably benign Het
Or5al6 G T 2: 85,976,877 (GRCm39) A67E probably damaging Het
Or8j3c C T 2: 86,253,805 (GRCm39) G72S possibly damaging Het
Otud6b T A 4: 14,826,293 (GRCm39) Q34L probably damaging Het
Parp11 C T 6: 127,448,599 (GRCm39) T72I probably damaging Het
Pbx1 T A 1: 168,011,158 (GRCm39) D343V possibly damaging Het
Phf11 T C 14: 59,495,932 (GRCm39) probably null Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Pramel15 C A 4: 144,099,878 (GRCm39) E296* probably null Het
Ranbp9 A T 13: 43,588,331 (GRCm39) I67N probably damaging Het
Rasgrp4 A G 7: 28,847,832 (GRCm39) E414G probably damaging Het
Rbbp5 A G 1: 132,418,226 (GRCm39) H15R possibly damaging Het
Scd2 A G 19: 44,289,710 (GRCm39) Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 (GRCm39) G170S probably damaging Het
Sh3bp4 G T 1: 89,073,317 (GRCm39) G722C probably damaging Het
Shmt1 A T 11: 60,688,305 (GRCm39) probably benign Het
Slc12a1 A G 2: 125,008,057 (GRCm39) I206V probably benign Het
Slc26a3 A G 12: 31,503,907 (GRCm39) D304G probably benign Het
Slc26a7 T A 4: 14,532,572 (GRCm39) D434V possibly damaging Het
Slc6a16 G T 7: 44,909,390 (GRCm39) M185I probably benign Het
Stat4 A G 1: 52,121,729 (GRCm39) I363V possibly damaging Het
Tgfb1i1 G T 7: 127,847,389 (GRCm39) M1I probably null Het
Thoc2l A G 5: 104,670,124 (GRCm39) K1549E possibly damaging Het
Tmem225 T C 9: 40,060,639 (GRCm39) V66A probably benign Het
Tmtc4 T C 14: 123,178,714 (GRCm39) probably null Het
Trpc4 T A 3: 54,102,217 (GRCm39) N38K probably benign Het
Ttll12 A T 15: 83,471,314 (GRCm39) Y218N probably damaging Het
Ttn A T 2: 76,778,769 (GRCm39) probably null Het
Tulp1 A C 17: 28,570,969 (GRCm39) Y178* probably null Het
Vmn2r58 A G 7: 41,513,746 (GRCm39) V299A probably damaging Het
Washc4 C A 10: 83,419,200 (GRCm39) Q911K possibly damaging Het
Wdr3 T C 3: 100,062,252 (GRCm39) D221G probably benign Het
Zan A T 5: 137,460,155 (GRCm39) C1245* probably null Het
Zfyve9 A C 4: 108,548,866 (GRCm39) S773A probably benign Het
Other mutations in Impg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Impg2 APN 16 56,081,968 (GRCm39) nonsense probably null
IGL01097:Impg2 APN 16 56,081,010 (GRCm39) critical splice donor site probably null
IGL01115:Impg2 APN 16 56,079,803 (GRCm39) missense possibly damaging 0.61
IGL01545:Impg2 APN 16 56,046,080 (GRCm39) splice site probably benign
IGL01644:Impg2 APN 16 56,080,233 (GRCm39) missense probably benign 0.04
IGL01690:Impg2 APN 16 56,025,568 (GRCm39) missense probably damaging 0.97
IGL01781:Impg2 APN 16 56,072,588 (GRCm39) missense probably benign 0.21
IGL01801:Impg2 APN 16 56,057,111 (GRCm39) missense probably damaging 0.97
IGL01980:Impg2 APN 16 56,041,890 (GRCm39) missense probably damaging 0.99
IGL02059:Impg2 APN 16 56,080,335 (GRCm39) missense probably damaging 1.00
IGL02140:Impg2 APN 16 56,079,831 (GRCm39) missense probably benign 0.05
IGL02206:Impg2 APN 16 56,079,960 (GRCm39) missense possibly damaging 0.92
IGL02245:Impg2 APN 16 56,089,445 (GRCm39) missense probably damaging 0.96
IGL02584:Impg2 APN 16 56,085,374 (GRCm39) missense probably damaging 1.00
IGL03061:Impg2 APN 16 56,088,779 (GRCm39) missense probably damaging 1.00
IGL03123:Impg2 APN 16 56,087,485 (GRCm39) missense probably damaging 1.00
IGL03280:Impg2 APN 16 56,088,631 (GRCm39) nonsense probably null
R0051:Impg2 UTSW 16 56,078,411 (GRCm39) missense probably damaging 1.00
R0117:Impg2 UTSW 16 56,082,005 (GRCm39) missense probably damaging 0.99
R0193:Impg2 UTSW 16 56,085,412 (GRCm39) nonsense probably null
R0270:Impg2 UTSW 16 56,089,378 (GRCm39) missense possibly damaging 0.88
R0326:Impg2 UTSW 16 56,080,848 (GRCm39) missense probably damaging 1.00
R0330:Impg2 UTSW 16 56,072,627 (GRCm39) missense probably damaging 0.99
R0812:Impg2 UTSW 16 56,078,302 (GRCm39) intron probably benign
R1074:Impg2 UTSW 16 56,085,541 (GRCm39) splice site probably benign
R1283:Impg2 UTSW 16 56,078,302 (GRCm39) intron probably benign
R1618:Impg2 UTSW 16 56,080,221 (GRCm39) missense probably damaging 0.97
R1708:Impg2 UTSW 16 56,085,441 (GRCm39) missense probably benign 0.10
R1713:Impg2 UTSW 16 56,080,889 (GRCm39) missense probably benign 0.25
R1827:Impg2 UTSW 16 56,087,583 (GRCm39) missense possibly damaging 0.62
R1853:Impg2 UTSW 16 56,080,640 (GRCm39) missense probably damaging 1.00
R2064:Impg2 UTSW 16 56,063,993 (GRCm39) critical splice donor site probably null
R2100:Impg2 UTSW 16 56,051,748 (GRCm39) splice site probably null
R2125:Impg2 UTSW 16 56,085,427 (GRCm39) missense probably damaging 1.00
R2128:Impg2 UTSW 16 56,038,742 (GRCm39) missense probably damaging 1.00
R2195:Impg2 UTSW 16 56,080,497 (GRCm39) missense probably benign 0.39
R2247:Impg2 UTSW 16 56,088,627 (GRCm39) missense probably damaging 0.97
R2366:Impg2 UTSW 16 56,080,236 (GRCm39) missense probably benign 0.04
R2411:Impg2 UTSW 16 56,072,517 (GRCm39) missense probably damaging 1.00
R4193:Impg2 UTSW 16 56,088,774 (GRCm39) missense probably benign 0.00
R4356:Impg2 UTSW 16 56,080,527 (GRCm39) missense probably damaging 1.00
R4424:Impg2 UTSW 16 56,080,388 (GRCm39) missense possibly damaging 0.56
R4575:Impg2 UTSW 16 56,082,095 (GRCm39) missense probably damaging 1.00
R4766:Impg2 UTSW 16 56,078,302 (GRCm39) intron probably benign
R5278:Impg2 UTSW 16 56,041,880 (GRCm39) missense probably benign 0.06
R5383:Impg2 UTSW 16 56,063,989 (GRCm39) missense probably benign 0.03
R5766:Impg2 UTSW 16 56,080,183 (GRCm39) missense possibly damaging 0.73
R5909:Impg2 UTSW 16 56,078,499 (GRCm39) missense probably damaging 0.99
R6525:Impg2 UTSW 16 56,025,512 (GRCm39) missense probably damaging 1.00
R6684:Impg2 UTSW 16 56,080,292 (GRCm39) missense probably benign 0.33
R6692:Impg2 UTSW 16 56,072,696 (GRCm39) missense probably damaging 1.00
R6711:Impg2 UTSW 16 56,085,449 (GRCm39) missense probably damaging 1.00
R6909:Impg2 UTSW 16 56,024,947 (GRCm39) missense probably damaging 0.97
R6959:Impg2 UTSW 16 56,088,693 (GRCm39) missense probably benign 0.01
R7226:Impg2 UTSW 16 56,087,467 (GRCm39) nonsense probably null
R7456:Impg2 UTSW 16 56,080,276 (GRCm39) missense probably benign 0.03
R7528:Impg2 UTSW 16 56,080,743 (GRCm39) missense possibly damaging 0.86
R7532:Impg2 UTSW 16 56,087,543 (GRCm39) missense probably damaging 0.96
R7601:Impg2 UTSW 16 56,080,394 (GRCm39) missense probably benign 0.22
R7803:Impg2 UTSW 16 56,087,513 (GRCm39) missense probably damaging 0.99
R8063:Impg2 UTSW 16 56,081,819 (GRCm39) intron probably benign
R8251:Impg2 UTSW 16 56,079,960 (GRCm39) missense possibly damaging 0.92
R8292:Impg2 UTSW 16 56,080,989 (GRCm39) missense probably damaging 1.00
R8481:Impg2 UTSW 16 56,072,629 (GRCm39) missense possibly damaging 0.76
R8524:Impg2 UTSW 16 56,038,757 (GRCm39) missense probably benign 0.03
R8782:Impg2 UTSW 16 56,079,818 (GRCm39) missense probably damaging 0.99
R8795:Impg2 UTSW 16 56,080,611 (GRCm39) missense probably benign 0.25
R8901:Impg2 UTSW 16 56,072,528 (GRCm39) missense probably damaging 1.00
R9243:Impg2 UTSW 16 56,051,823 (GRCm39) missense probably damaging 1.00
R9352:Impg2 UTSW 16 56,072,470 (GRCm39) missense probably benign 0.00
R9645:Impg2 UTSW 16 56,038,767 (GRCm39) missense probably damaging 0.99
X0023:Impg2 UTSW 16 56,080,239 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACATAGATATGGAGATAGGCCCATAC -3'
(R):5'- TCAACCAGAGTCTGTCAGTGC -3'

Sequencing Primer
(F):5'- CATCTTTGTAGAGTCCGCAAC -3'
(R):5'- CAGAGTCTGTCAGTGCTCTCTG -3'
Posted On 2016-06-06