Incidental Mutation 'R5025:Mrpl15'
ID391279
Institutional Source Beutler Lab
Gene Symbol Mrpl15
Ensembl Gene ENSMUSG00000033845
Gene Namemitochondrial ribosomal protein L15
SynonymsMRP-L7, HSPC145, Rpml7
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5025 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location4773206-4785739 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 4784145 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045689] [ENSMUST00000130201] [ENSMUST00000146665] [ENSMUST00000156816]
Predicted Effect probably benign
Transcript: ENSMUST00000045689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115538
Predicted Effect probably benign
Transcript: ENSMUST00000130201
SMART Domains Protein: ENSMUSP00000114649
Gene: ENSMUSG00000033845

DomainStartEndE-ValueType
Pfam:Ribosomal_L18e 42 176 4.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132625
Predicted Effect probably benign
Transcript: ENSMUST00000146665
SMART Domains Protein: ENSMUSP00000141204
Gene: ENSMUSG00000033845

DomainStartEndE-ValueType
Pfam:Ribosomal_L18e 42 126 6.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156816
SMART Domains Protein: ENSMUSP00000115512
Gene: ENSMUSG00000033845

DomainStartEndE-ValueType
Pfam:Ribosomal_L18e 44 175 5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195445
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the EcoL15 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 15q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Mrpl15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Mrpl15 APN 1 4776531 missense probably damaging 1.00
IGL02307:Mrpl15 APN 1 4783953 missense possibly damaging 0.82
IGL02390:Mrpl15 APN 1 4785614 missense probably benign 0.01
IGL03054:Mrpl15 UTSW 1 4785571 critical splice donor site probably null
R0730:Mrpl15 UTSW 1 4777611 missense probably damaging 1.00
R1938:Mrpl15 UTSW 1 4777582 missense probably damaging 0.99
R4855:Mrpl15 UTSW 1 4774460 missense probably benign 0.05
R5951:Mrpl15 UTSW 1 4785733 utr 5 prime probably benign
R6723:Mrpl15 UTSW 1 4782566 critical splice donor site probably null
R6802:Mrpl15 UTSW 1 4776730 missense probably benign 0.03
R6988:Mrpl15 UTSW 1 4782660 missense probably benign 0.10
R7057:Mrpl15 UTSW 1 4776642 missense probably benign
R7236:Mrpl15 UTSW 1 4776488 missense probably benign
R7573:Mrpl15 UTSW 1 4777555 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAACAGTACCATAAGTGTGTTC -3'
(R):5'- AGAACTTTGCCCTGTGTTTCAC -3'

Sequencing Primer
(F):5'- TGTGTACTTCTTAGTGGAAATTACG -3'
(R):5'- CACCTTGTATTTTGGTTACTAGGATC -3'
Posted On2016-06-06