Incidental Mutation 'R5025:Zc3h6'
ID 391284
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms
MMRRC Submission 042616-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.214) question?
Stock # R5025 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 128967402-129018563 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129010433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 330 (F330I)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000110320
AA Change: F330I

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: F330I

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Meta Mutation Damage Score 0.1151 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 splice site probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
R7924:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 129017014 missense probably benign 0.30
R8877:Zc3h6 UTSW 2 129014399 nonsense probably null
R9076:Zc3h6 UTSW 2 129017176 nonsense probably null
R9577:Zc3h6 UTSW 2 129016182 missense
R9687:Zc3h6 UTSW 2 129017361 missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 129017235 missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGGAAGGTAATCATCTTTGTTACAG -3'
(R):5'- CCCTTGTAACATTTTGGAGTATTGGTC -3'

Sequencing Primer
(F):5'- GCTCAGTAAAGTACTTCTGAGAGCC -3'
(R):5'- AGTCAGATCATCATGGGAA -3'
Posted On 2016-06-06