Mutagenetix > Incidental Mutation

Incidental Mutation 'R5025:Zc3h6'

391284

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

MMRRC Submission

042616-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R5025 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 129010433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 330 (F330I)

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110320
AA Change: F330I

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: F330I

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Meta Mutation Damage Score

0.1151

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,554,496	F10I	unknown	Het
Adad1	G	T	3: 37,065,210	A147S	probably damaging	Het
Atg14	T	G	14: 47,545,816	N354T	probably damaging	Het
Brip1	T	A	11: 86,064,980	E902D	probably benign	Het
Brwd1	A	G	16: 96,053,972	S419P	probably damaging	Het
Camsap3	A	G	8: 3,604,244	K638R	probably damaging	Het
Dennd4c	T	A	4: 86,795,299		probably null	Het
Dnah3	T	C	7: 120,071,905	N585S	probably benign	Het
Eef1akmt2	C	A	7: 132,851,489	W38L	probably damaging	Het
Fasn	A	T	11: 120,811,908	D1709E	probably benign	Het
Fbrsl1	T	C	5: 110,417,901	D179G	probably damaging	Het
Fbxl18	A	T	5: 142,886,313	I389N	probably damaging	Het
Fuca1	G	T	4: 135,932,926	G252C	probably damaging	Het
Fut9	T	A	4: 25,620,502	H104L	probably damaging	Het
Glra1	C	T	11: 55,536,505		probably null	Het
Gpsm1	T	C	2: 26,319,996	V45A	possibly damaging	Het
Hadha	A	G	5: 30,154,961		probably benign	Het
Hddc2	C	T	10: 31,327,953	T192I	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Igkv14-100	A	G	6: 68,519,399	D92G	probably damaging	Het
Il17rc	T	C	6: 113,472,366	V88A	possibly damaging	Het
Inpp5j	T	C	11: 3,500,664	D563G	probably damaging	Het
Lamc3	T	A	2: 31,908,669	N462K	probably benign	Het
Mrpl15	T	C	1: 4,784,145		probably benign	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Olfr135	T	C	17: 38,208,443	L66P	probably damaging	Het
Olfr1484	G	T	19: 13,585,522	A30S	probably benign	Het
Psg20	T	C	7: 18,674,366	*473W	probably null	Het
Rimbp3	A	G	16: 17,209,807	E365G	probably damaging	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Snai2	A	G	16: 14,708,189	T235A	possibly damaging	Het
Tg	A	T	15: 66,707,930	Y1528F	probably damaging	Het
Tlr3	A	G	8: 45,403,038	V35A	probably benign	Het
Tnfsf15	T	C	4: 63,729,888	I172V	probably benign	Het
Tns1	G	A	1: 73,925,482	T1330I	probably damaging	Het
Zdbf2	A	G	1: 63,303,650	E396G	possibly damaging	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R2899:Zc3h6	UTSW	2	129002232	missense	probably benign	0.00
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R3893:Zc3h6	UTSW	2	129016140	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5026:Zc3h6	UTSW	2	129017309	missense	probably benign	0.00
R5125:Zc3h6	UTSW	2	129014479	missense	possibly damaging	0.93
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5802:Zc3h6	UTSW	2	129015559	missense	possibly damaging	0.56
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7572:Zc3h6	UTSW	2	129017252	missense	probably benign	0.02
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7797:Zc3h6	UTSW	2	129015635	critical splice donor site	probably null
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
R8877:Zc3h6	UTSW	2	129014399	nonsense	probably null
R9076:Zc3h6	UTSW	2	129017176	nonsense	probably null
R9577:Zc3h6	UTSW	2	129016182	missense
R9687:Zc3h6	UTSW	2	129017361	missense	probably damaging	1.00
R9745:Zc3h6	UTSW	2	129017235	missense	probably benign	0.08
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCTGGAAGGTAATCATCTTTGTTACAG -3'
(R):5'- CCCTTGTAACATTTTGGAGTATTGGTC -3'

Sequencing Primer
(F):5'- GCTCAGTAAAGTACTTCTGAGAGCC -3'
(R):5'- AGTCAGATCATCATGGGAA -3'

Posted On

2016-06-06