Incidental Mutation 'R5025:Adad1'
ID 391285
Institutional Source Beutler Lab
Gene Symbol Adad1
Ensembl Gene ENSMUSG00000027719
Gene Name adenosine deaminase domain containing 1 (testis specific)
Synonyms
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R5025 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 37063527-37121930 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 37065210 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 147 (A147S)
Ref Sequence ENSEMBL: ENSMUSP00000115260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029274] [ENSMUST00000144629]
AlphaFold Q5SUE7
Predicted Effect possibly damaging
Transcript: ENSMUST00000029274
AA Change: A87S

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029274
Gene: ENSMUSG00000027719
AA Change: A87S

DomainStartEndE-ValueType
DSRM 79 145 4.04e-15 SMART
low complexity region 154 176 N/A INTRINSIC
ADEAMc 186 547 2.51e-165 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141736
Predicted Effect probably damaging
Transcript: ENSMUST00000144629
AA Change: A147S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115260
Gene: ENSMUSG00000027719
AA Change: A147S

DomainStartEndE-ValueType
Blast:DSRM 51 108 5e-20 BLAST
DSRM 139 205 4.04e-15 SMART
low complexity region 214 236 N/A INTRINSIC
ADEAMc 246 618 4.77e-180 SMART
Meta Mutation Damage Score 0.2345 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Male mice homozygous for a mutated allele have reduced sperm counts and motility, and increased sperm malformation resulting in background dependent sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Adad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Adad1 APN 3 37092034 missense probably damaging 1.00
IGL01903:Adad1 APN 3 37085082 splice site probably null
IGL02501:Adad1 APN 3 37083340 missense probably damaging 0.99
IGL02703:Adad1 APN 3 37064241 missense probably damaging 1.00
IGL03354:Adad1 APN 3 37106173 missense probably damaging 1.00
R0042:Adad1 UTSW 3 37083173 unclassified probably benign
R0233:Adad1 UTSW 3 37084948 missense possibly damaging 0.91
R0233:Adad1 UTSW 3 37084948 missense possibly damaging 0.91
R0928:Adad1 UTSW 3 37076740 critical splice donor site probably null
R1704:Adad1 UTSW 3 37092015 missense probably benign
R4081:Adad1 UTSW 3 37064363 splice site probably null
R4596:Adad1 UTSW 3 37065192 missense probably damaging 1.00
R4613:Adad1 UTSW 3 37092033 missense probably damaging 1.00
R4810:Adad1 UTSW 3 37092034 missense probably damaging 1.00
R4855:Adad1 UTSW 3 37085111 missense probably damaging 1.00
R4884:Adad1 UTSW 3 37076664 missense possibly damaging 0.94
R5286:Adad1 UTSW 3 37065250 missense possibly damaging 0.75
R5356:Adad1 UTSW 3 37065256 missense probably damaging 1.00
R5948:Adad1 UTSW 3 37083355 critical splice donor site probably null
R6091:Adad1 UTSW 3 37084969 missense possibly damaging 0.93
R7230:Adad1 UTSW 3 37065166 missense probably damaging 1.00
R7882:Adad1 UTSW 3 37079802 missense probably damaging 1.00
R7994:Adad1 UTSW 3 37091971 missense possibly damaging 0.67
R8342:Adad1 UTSW 3 37079901 missense probably damaging 1.00
R9080:Adad1 UTSW 3 37065249 missense probably benign 0.34
R9337:Adad1 UTSW 3 37085098 missense possibly damaging 0.71
R9443:Adad1 UTSW 3 37091991 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGTCTAGTAGGAACTTGGGG -3'
(R):5'- GATCAACACTGACAGAAATGTGTC -3'

Sequencing Primer
(F):5'- GGGAAAACATGCTTATTGTATAAGGG -3'
(R):5'- ACAGAAATGTGTCTTTATTTTGTCAC -3'
Posted On 2016-06-06