Incidental Mutation 'R5025:Fut9'
ID391287
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Namefucosyltransferase 9
SynonymsmFuc-TIX, mFUT9
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5025 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location25609332-25800244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25620502 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 104 (H104L)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
Predicted Effect probably damaging
Transcript: ENSMUST00000084770
AA Change: H104L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: H104L

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108199
AA Change: H104L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: H104L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25620316 missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25620446 missense probably benign 0.13
IGL01330:Fut9 APN 4 25619791 missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25619867 missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25620037 missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25620802 missense probably benign 0.25
R0280:Fut9 UTSW 4 25619852 missense probably benign 0.00
R0408:Fut9 UTSW 4 25620319 missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25620526 missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25620811 start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25620359 missense probably damaging 1.00
R1567:Fut9 UTSW 4 25620344 missense probably damaging 0.99
R1719:Fut9 UTSW 4 25619744 missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25620352 missense probably damaging 1.00
R2036:Fut9 UTSW 4 25620322 missense probably damaging 1.00
R2165:Fut9 UTSW 4 25619733 makesense probably null
R2165:Fut9 UTSW 4 25619734 makesense probably null
R2332:Fut9 UTSW 4 25619823 nonsense probably null
R4539:Fut9 UTSW 4 25619793 missense probably damaging 1.00
R4722:Fut9 UTSW 4 25799734 utr 5 prime probably benign
R4766:Fut9 UTSW 4 25799191 intron probably benign
R4937:Fut9 UTSW 4 25799591 splice site probably benign
R5032:Fut9 UTSW 4 25799245 intron probably benign
R5158:Fut9 UTSW 4 25620731 missense probably benign 0.01
R5601:Fut9 UTSW 4 25620299 missense probably benign 0.00
R5974:Fut9 UTSW 4 25620090 nonsense probably null
R6315:Fut9 UTSW 4 25619774 missense probably damaging 1.00
R6385:Fut9 UTSW 4 25620328 missense probably damaging 1.00
R6652:Fut9 UTSW 4 25620619 missense probably benign 0.44
R6809:Fut9 UTSW 4 25620647 missense probably benign
R6825:Fut9 UTSW 4 25619925 missense probably benign
R7145:Fut9 UTSW 4 25620507 missense probably damaging 0.96
X0057:Fut9 UTSW 4 25799686 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCGTCAAGAAGCCATAAGG -3'
(R):5'- CCAATGGAGTCTGCAAGTTCTG -3'

Sequencing Primer
(F):5'- CACTTGGATATCTGAATCACGGCG -3'
(R):5'- CTGCAAGTTCTGTGCTGAAAATG -3'
Posted On2016-06-06