Incidental Mutation 'R5025:Hadha'
ID391291
Institutional Source Beutler Lab
Gene Symbol Hadha
Ensembl Gene ENSMUSG00000025745
Gene Namehydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit
SynonymsMtpa
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5025 (G1)
Quality Score162
Status Validated
Chromosome5
Chromosomal Location30118304-30155162 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 30154961 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026841] [ENSMUST00000114783] [ENSMUST00000114786] [ENSMUST00000123980] [ENSMUST00000156859] [ENSMUST00000197109]
Predicted Effect probably benign
Transcript: ENSMUST00000026841
SMART Domains Protein: ENSMUSP00000026841
Gene: ENSMUSG00000059447

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026843
Predicted Effect probably benign
Transcript: ENSMUST00000114783
SMART Domains Protein: ENSMUSP00000110431
Gene: ENSMUSG00000059447

DomainStartEndE-ValueType
Pfam:Thiolase_N 55 325 1.4e-90 PFAM
Pfam:ketoacyl-synt 90 194 1.4e-10 PFAM
Pfam:Thiolase_C 332 472 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114786
SMART Domains Protein: ENSMUSP00000110434
Gene: ENSMUSG00000059447

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123980
SMART Domains Protein: ENSMUSP00000118296
Gene: ENSMUSG00000059447

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 129 3.7e-20 PFAM
Pfam:Thiolase_N 119 173 3.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130358
Predicted Effect probably benign
Transcript: ENSMUST00000156859
SMART Domains Protein: ENSMUSP00000120976
Gene: ENSMUSG00000025745

DomainStartEndE-ValueType
Pfam:ECH_1 44 297 3.6e-42 PFAM
Pfam:ECH_2 49 225 8.6e-27 PFAM
Pfam:3HCDH_N 363 542 1e-54 PFAM
Pfam:3HCDH 544 639 7.7e-29 PFAM
low complexity region 706 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196156
Predicted Effect probably benign
Transcript: ENSMUST00000197109
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the alpha subunit catalyzing the 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities. Mutations in this gene result in trifunctional protein deficiency or LCHAD deficiency. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within 36 hours with hypoglycemia and liver steatosis. Liver steatosis and insulin resistance develop in heterozygotes with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Hadha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Hadha APN 5 30120147 missense possibly damaging 0.94
IGL00435:Hadha APN 5 30122173 missense probably benign 0.12
IGL01413:Hadha APN 5 30141027 missense probably benign 0.01
IGL01715:Hadha APN 5 30120084 missense probably damaging 1.00
IGL02065:Hadha APN 5 30142845 splice site probably benign
IGL02316:Hadha APN 5 30126567 missense probably benign 0.04
IGL02366:Hadha APN 5 30135050 missense probably benign 0.01
IGL02453:Hadha APN 5 30144306 splice site probably benign
IGL02611:Hadha APN 5 30128943 splice site probably benign
IGL03127:Hadha APN 5 30134186 splice site probably benign
IGL03181:Hadha APN 5 30121526 missense probably benign 0.20
R1381:Hadha UTSW 5 30128836 missense probably benign
R1501:Hadha UTSW 5 30128806 missense probably benign 0.02
R2060:Hadha UTSW 5 30128836 missense probably benign 0.30
R3764:Hadha UTSW 5 30144209 missense probably damaging 1.00
R3778:Hadha UTSW 5 30120129 missense probably damaging 0.98
R5523:Hadha UTSW 5 30145254 missense possibly damaging 0.78
R5870:Hadha UTSW 5 30144286 missense possibly damaging 0.61
R6054:Hadha UTSW 5 30123684 missense probably benign 0.00
R6144:Hadha UTSW 5 30140996 missense probably benign 0.04
R6245:Hadha UTSW 5 30120044 critical splice donor site probably null
R6495:Hadha UTSW 5 30120050 missense probably benign 0.03
R6862:Hadha UTSW 5 30147979 critical splice donor site probably null
R7038:Hadha UTSW 5 30120000 intron probably null
R7200:Hadha UTSW 5 30145317 missense probably benign 0.25
R7215:Hadha UTSW 5 30119842 missense probably benign 0.00
R7267:Hadha UTSW 5 30122757 missense probably damaging 1.00
R7414:Hadha UTSW 5 30126612 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAGTAGCCCCATTTCCACG -3'
(R):5'- AGGTCCTTAGTCTCACCTTCAGAG -3'

Sequencing Primer
(F):5'- CCATTTCCACGGGTCCC -3'
(R):5'- AGAGAAATCATCCTTTCGGCTCG -3'
Posted On2016-06-06