Incidental Mutation 'R5025:Il17rc'
ID391296
Institutional Source Beutler Lab
Gene Symbol Il17rc
Ensembl Gene ENSMUSG00000030281
Gene Nameinterleukin 17 receptor C
Synonyms1110025H02Rik, IL17-RL, Il17rl
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5025 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113471427-113483140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113472366 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 88 (V88A)
Ref Sequence ENSEMBL: ENSMUSP00000055343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053569] [ENSMUST00000058300] [ENSMUST00000058548] [ENSMUST00000101065] [ENSMUST00000203281] [ENSMUST00000203661] [ENSMUST00000204774]
Predicted Effect probably benign
Transcript: ENSMUST00000053569
SMART Domains Protein: ENSMUSP00000054378
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000058300
AA Change: V88A

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281
AA Change: V88A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058548
SMART Domains Protein: ENSMUSP00000062103
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 6.2e-121 PFAM
transmembrane domain 415 437 N/A INTRINSIC
Pfam:SEFIR 448 585 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101065
SMART Domains Protein: ENSMUSP00000098626
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect not run
Transcript: ENSMUST00000147316
AA Change: V28A
Predicted Effect probably benign
Transcript: ENSMUST00000203281
SMART Domains Protein: ENSMUSP00000145363
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203661
SMART Domains Protein: ENSMUSP00000145345
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
Pfam:SEFIR 403 539 1.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203897
Predicted Effect probably benign
Transcript: ENSMUST00000204447
AA Change: V28A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000204632
Predicted Effect probably benign
Transcript: ENSMUST00000204774
SMART Domains Protein: ENSMUSP00000145384
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:SEFIR 428 565 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205211
Meta Mutation Damage Score 0.1295 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane protein that shares similarity with the interleukin-17 receptor (IL-17RA). Unlike IL-17RA, which is predominantly expressed in hemopoietic cells, and binds with high affinity to only IL-17A, this protein is expressed in nonhemopoietic tissues, and binds both IL-17A and IL-17F with similar affinities. The proinflammatory cytokines, IL-17A and IL-17F, have been implicated in the progression of inflammatory and autoimmune diseases. Multiple alternatively spliced transcript variants encoding different isoforms have been detected for this gene, and it has been proposed that soluble, secreted proteins lacking transmembrane and intracellular domains may function as extracellular antagonists to cytokine signaling. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit increased interleukin-17 secretion, reduced chemokine expression, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Il17rc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Il17rc APN 6 113474171 missense probably damaging 0.96
IGL03192:Il17rc APN 6 113472885 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R4075:Il17rc UTSW 6 113481197 missense possibly damaging 0.82
R5052:Il17rc UTSW 6 113472323 missense probably damaging 1.00
R5148:Il17rc UTSW 6 113482997 missense probably benign 0.19
R5302:Il17rc UTSW 6 113483036 missense possibly damaging 0.71
R5977:Il17rc UTSW 6 113482731 missense probably damaging 0.98
R6275:Il17rc UTSW 6 113480347 missense probably benign 0.00
R7010:Il17rc UTSW 6 113479288 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGAATGACTTCCAGGCGAGC -3'
(R):5'- ATGCCATGGCGCATAAGCAG -3'

Sequencing Primer
(F):5'- TGACTTCCAGGCGAGCTGAAG -3'
(R):5'- CGCATAAGCAGAGGCCTG -3'
Posted On2016-06-06