Incidental Mutation 'R5025:Inpp5j'
ID391303
Institutional Source Beutler Lab
Gene Symbol Inpp5j
Ensembl Gene ENSMUSG00000034570
Gene Nameinositol polyphosphate 5-phosphatase J
SynonymsPipp, Pib5pa
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R5025 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3494375-3504821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3500664 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 563 (D563G)
Ref Sequence ENSEMBL: ENSMUSP00000139302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044507] [ENSMUST00000044682] [ENSMUST00000110018] [ENSMUST00000110019] [ENSMUST00000154756] [ENSMUST00000183684]
Predicted Effect probably benign
Transcript: ENSMUST00000044507
AA Change: D563G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046625
Gene: ENSMUSG00000034570
AA Change: D563G

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 840 862 N/A INTRINSIC
low complexity region 868 887 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 992 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044682
SMART Domains Protein: ENSMUSP00000041571
Gene: ENSMUSG00000034579

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 139 259 1.58e-2 SMART
low complexity region 305 324 N/A INTRINSIC
Pfam:Phospholip_A2_2 343 431 4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110018
SMART Domains Protein: ENSMUSP00000105645
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110019
SMART Domains Protein: ENSMUSP00000105646
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148939
AA Change: D191G
Predicted Effect probably damaging
Transcript: ENSMUST00000154756
AA Change: D563G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139302
Gene: ENSMUSG00000034570
AA Change: D563G

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 870 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183684
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile, and show normal mammary gland development and no spontaneous mammary tumors. However, in an oncogene-driven breast cancer mouse model, mice show increased mammary hyperplasia and tumor growth paradoxically associated with reduced lung metastases. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Inpp5j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Inpp5j APN 11 3500009 splice site probably benign
IGL00435:Inpp5j APN 11 3502255 missense probably benign 0.00
IGL00509:Inpp5j APN 11 3501595 missense possibly damaging 0.94
IGL00916:Inpp5j APN 11 3502389 missense probably damaging 1.00
IGL00975:Inpp5j APN 11 3502176 missense probably damaging 1.00
IGL01523:Inpp5j APN 11 3495932 unclassified probably null
IGL02472:Inpp5j APN 11 3495338 unclassified probably benign
IGL02512:Inpp5j APN 11 3499661 missense probably damaging 1.00
IGL02897:Inpp5j APN 11 3500619 missense probably damaging 1.00
IGL03408:Inpp5j APN 11 3502809 missense possibly damaging 0.95
R0048:Inpp5j UTSW 11 3501417 missense probably damaging 0.97
R0440:Inpp5j UTSW 11 3501150 missense possibly damaging 0.95
R0455:Inpp5j UTSW 11 3503122 missense possibly damaging 0.66
R0483:Inpp5j UTSW 11 3499738 missense probably damaging 1.00
R0554:Inpp5j UTSW 11 3499644 missense probably damaging 1.00
R0639:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0673:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0926:Inpp5j UTSW 11 3501439 splice site probably benign
R1114:Inpp5j UTSW 11 3494814 missense possibly damaging 0.57
R1132:Inpp5j UTSW 11 3502305 missense possibly damaging 0.90
R1463:Inpp5j UTSW 11 3501147 missense probably benign 0.03
R1757:Inpp5j UTSW 11 3504738 missense possibly damaging 0.49
R1978:Inpp5j UTSW 11 3502150 missense probably damaging 1.00
R3078:Inpp5j UTSW 11 3503124 unclassified probably null
R3831:Inpp5j UTSW 11 3500229 missense probably damaging 1.00
R4012:Inpp5j UTSW 11 3500185 missense probably benign 0.06
R4183:Inpp5j UTSW 11 3501134 missense probably damaging 0.99
R4209:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4210:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4211:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4477:Inpp5j UTSW 11 3501625 missense probably damaging 1.00
R4729:Inpp5j UTSW 11 3495025 missense probably damaging 0.99
R4840:Inpp5j UTSW 11 3499676 missense probably damaging 1.00
R5151:Inpp5j UTSW 11 3502270 missense probably damaging 1.00
R5195:Inpp5j UTSW 11 3499889 critical splice donor site probably null
R5623:Inpp5j UTSW 11 3494766 missense probably damaging 0.96
R6262:Inpp5j UTSW 11 3502615 missense probably benign 0.02
R6448:Inpp5j UTSW 11 3495387 missense probably damaging 0.99
R6465:Inpp5j UTSW 11 3502293 missense possibly damaging 0.84
R6723:Inpp5j UTSW 11 3500640 missense probably damaging 0.99
R6895:Inpp5j UTSW 11 3495557 splice site probably null
R7060:Inpp5j UTSW 11 3500133 splice site probably null
R7346:Inpp5j UTSW 11 3501065 missense probably damaging 1.00
T0975:Inpp5j UTSW 11 3502527 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTCAGCAAAGCTCTACCTTGC -3'
(R):5'- AGCCTCCTATGCTCCTCACAAG -3'

Sequencing Primer
(F):5'- AAGCTCTACCTTGCAGGATC -3'
(R):5'- ACAAGTTCTTGTGGCCAGC -3'
Posted On2016-06-06