Mutagenetix > Incidental Mutations

Incidental Mutation 'R5025:Rimbp3'

391310

Institutional Source

Beutler Lab

Gene Symbol

Rimbp3

Ensembl Gene

ENSMUSG00000071636

Gene Name

RIMS binding protein 3

Synonyms

RIM-BP3, LOC239731, LOC385766

MMRRC Submission

042616-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.247) question?

Stock #

R5025 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

17208603-17213982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17209807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 365 (E365G)

Ref Sequence

ENSEMBL: ENSMUSP00000127909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169803]

AlphaFold

Q3V0F0

Predicted Effect

probably damaging
Transcript: ENSMUST00000169803
AA Change: E365G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: E365G

Domain	Start	End	E-Value	Type
coiled coil region	25	56	N/A	INTRINSIC
coiled coil region	84	145	N/A	INTRINSIC
low complexity region	308	324	N/A	INTRINSIC
coiled coil region	395	431	N/A	INTRINSIC
coiled coil region	547	610	N/A	INTRINSIC
low complexity region	688	701	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
SH3	825	888	7.58e-8	SMART
low complexity region	913	924	N/A	INTRINSIC
FN3	980	1052	2.21e-3	SMART
FN3	1073	1160	1.91e1	SMART
low complexity region	1236	1243	N/A	INTRINSIC
SH3	1423	1487	5.08e-2	SMART
SH3	1539	1602	5.97e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179034

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,554,496	F10I	unknown	Het
Adad1	G	T	3: 37,065,210	A147S	probably damaging	Het
Atg14	T	G	14: 47,545,816	N354T	probably damaging	Het
Brip1	T	A	11: 86,064,980	E902D	probably benign	Het
Brwd1	A	G	16: 96,053,972	S419P	probably damaging	Het
Camsap3	A	G	8: 3,604,244	K638R	probably damaging	Het
Dennd4c	T	A	4: 86,795,299		probably null	Het
Dnah3	T	C	7: 120,071,905	N585S	probably benign	Het
Eef1akmt2	C	A	7: 132,851,489	W38L	probably damaging	Het
Fasn	A	T	11: 120,811,908	D1709E	probably benign	Het
Fbrsl1	T	C	5: 110,417,901	D179G	probably damaging	Het
Fbxl18	A	T	5: 142,886,313	I389N	probably damaging	Het
Fuca1	G	T	4: 135,932,926	G252C	probably damaging	Het
Fut9	T	A	4: 25,620,502	H104L	probably damaging	Het
Glra1	C	T	11: 55,536,505		probably null	Het
Gpsm1	T	C	2: 26,319,996	V45A	possibly damaging	Het
Hadha	A	G	5: 30,154,961		probably benign	Het
Hddc2	C	T	10: 31,327,953	T192I	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Igkv14-100	A	G	6: 68,519,399	D92G	probably damaging	Het
Il17rc	T	C	6: 113,472,366	V88A	possibly damaging	Het
Inpp5j	T	C	11: 3,500,664	D563G	probably damaging	Het
Lamc3	T	A	2: 31,908,669	N462K	probably benign	Het
Mrpl15	T	C	1: 4,784,145		probably benign	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Olfr135	T	C	17: 38,208,443	L66P	probably damaging	Het
Olfr1484	G	T	19: 13,585,522	A30S	probably benign	Het
Psg20	T	C	7: 18,674,366	*473W	probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Snai2	A	G	16: 14,708,189	T235A	possibly damaging	Het
Tg	A	T	15: 66,707,930	Y1528F	probably damaging	Het
Tlr3	A	G	8: 45,403,038	V35A	probably benign	Het
Tnfsf15	T	C	4: 63,729,888	I172V	probably benign	Het
Tns1	G	A	1: 73,925,482	T1330I	probably damaging	Het
Zc3h6	T	A	2: 129,010,433	F330I	possibly damaging	Het
Zdbf2	A	G	1: 63,303,650	E396G	possibly damaging	Het

Other mutations in Rimbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rimbp3	APN	16	17209743	missense	probably benign	0.01
IGL00786:Rimbp3	APN	16	17211688	missense	probably damaging	0.99
IGL01411:Rimbp3	APN	16	17211094	missense	probably damaging	1.00
IGL01434:Rimbp3	APN	16	17211702	missense	probably benign	0.13
IGL01895:Rimbp3	APN	16	17211436	missense	probably damaging	0.99
IGL02322:Rimbp3	APN	16	17211615	missense	probably benign	0.00
IGL02649:Rimbp3	APN	16	17209608	nonsense	probably null
IGL03285:Rimbp3	APN	16	17213232	missense	probably benign	0.16
PIT4581001:Rimbp3	UTSW	16	17210716	missense	possibly damaging	0.76
R0279:Rimbp3	UTSW	16	17209453	missense	probably benign	0.00
R0465:Rimbp3	UTSW	16	17211780	missense	possibly damaging	0.86
R0605:Rimbp3	UTSW	16	17211699	missense	probably damaging	0.99
R0674:Rimbp3	UTSW	16	17212737	missense	probably benign	0.02
R1676:Rimbp3	UTSW	16	17211113	missense	probably benign	0.13
R1780:Rimbp3	UTSW	16	17212632	missense	probably benign
R1946:Rimbp3	UTSW	16	17210427	missense	probably benign	0.10
R2113:Rimbp3	UTSW	16	17209675	missense	probably benign	0.00
R3847:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3849:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3850:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R4355:Rimbp3	UTSW	16	17209692	missense	possibly damaging	0.56
R4646:Rimbp3	UTSW	16	17213098	missense	probably damaging	0.99
R4669:Rimbp3	UTSW	16	17209189	missense	possibly damaging	0.88
R4732:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R4733:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R5039:Rimbp3	UTSW	16	17213331	missense	probably damaging	0.99
R5177:Rimbp3	UTSW	16	17209917	missense	possibly damaging	0.85
R5311:Rimbp3	UTSW	16	17210844	missense	probably benign	0.00
R5942:Rimbp3	UTSW	16	17211888	missense	probably benign	0.00
R6063:Rimbp3	UTSW	16	17210917	missense	probably damaging	1.00
R6092:Rimbp3	UTSW	16	17212270	missense	probably damaging	1.00
R6126:Rimbp3	UTSW	16	17212276	missense	probably benign	0.25
R6288:Rimbp3	UTSW	16	17212908	missense	probably benign	0.22
R6446:Rimbp3	UTSW	16	17212929	missense	probably benign	0.00
R6773:Rimbp3	UTSW	16	17209015	missense	probably damaging	1.00
R7017:Rimbp3	UTSW	16	17209746	missense	probably benign	0.04
R7043:Rimbp3	UTSW	16	17211108	missense	probably damaging	1.00
R7048:Rimbp3	UTSW	16	17210326	missense	probably benign	0.20
R7378:Rimbp3	UTSW	16	17211204	missense	probably benign
R7440:Rimbp3	UTSW	16	17213201	missense	possibly damaging	0.78
R7788:Rimbp3	UTSW	16	17212704	missense	probably benign	0.00
R7879:Rimbp3	UTSW	16	17211046	missense	possibly damaging	0.71
R8071:Rimbp3	UTSW	16	17210863	missense	probably benign
R8272:Rimbp3	UTSW	16	17209105	missense	possibly damaging	0.85
R8419:Rimbp3	UTSW	16	17213022	missense	probably damaging	0.97
R8819:Rimbp3	UTSW	16	17210907	missense	probably benign	0.17
R8830:Rimbp3	UTSW	16	17209006	missense	probably damaging	0.98
R8936:Rimbp3	UTSW	16	17213020	missense	probably benign
R8982:Rimbp3	UTSW	16	17209647	missense	probably benign	0.11
R9365:Rimbp3	UTSW	16	17208756	missense	possibly damaging	0.93
Z1176:Rimbp3	UTSW	16	17209474	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGCTCCCAGGCTTCTGAATC -3'
(R):5'- AGATTGGTCTCCTGAAGCTTGC -3'

Sequencing Primer
(F):5'- CCAGGCTTCTGAATCCGAGGTAAG -3'
(R):5'- TGCGGGCCCTGTCTTCAAG -3'

Posted On

2016-06-06