Incidental Mutation 'R5025:Olfr135'
ID391312
Institutional Source Beutler Lab
Gene Symbol Olfr135
Ensembl Gene ENSMUSG00000057801
Gene Nameolfactory receptor 135
SynonymsGA_x6K02T2PSCP-2656648-2657586, MOR256-48
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5025 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38204335-38210915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38208443 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 66 (L66P)
Ref Sequence ENSEMBL: ENSMUSP00000150535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076245] [ENSMUST00000213217]
Predicted Effect probably damaging
Transcript: ENSMUST00000076245
AA Change: L66P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075595
Gene: ENSMUSG00000057801
AA Change: L66P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.6e-50 PFAM
Pfam:7tm_1 41 290 9.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213217
AA Change: L66P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Olfr135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr135 APN 17 38208982 missense probably damaging 0.99
IGL01316:Olfr135 APN 17 38208497 missense probably damaging 0.98
IGL01666:Olfr135 APN 17 38208889 missense probably benign 0.11
IGL02096:Olfr135 APN 17 38209183 makesense probably null
R0255:Olfr135 UTSW 17 38208395 missense probably benign
R0630:Olfr135 UTSW 17 38208413 missense probably damaging 0.97
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1279:Olfr135 UTSW 17 38208787 missense probably benign 0.01
R1878:Olfr135 UTSW 17 38208374 missense probably benign 0.03
R1969:Olfr135 UTSW 17 38208464 missense probably damaging 1.00
R2374:Olfr135 UTSW 17 38209067 missense probably damaging 0.97
R3708:Olfr135 UTSW 17 38208283 missense probably benign 0.01
R5093:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5095:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5103:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5104:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5105:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5149:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5150:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5344:Olfr135 UTSW 17 38209104 missense probably damaging 1.00
R6608:Olfr135 UTSW 17 38208479 missense probably damaging 1.00
R7300:Olfr135 UTSW 17 38208697 missense possibly damaging 0.76
R7324:Olfr135 UTSW 17 38208716 missense probably benign
R7580:Olfr135 UTSW 17 38209043 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACCCAGAAGAGTTTATTCTACTTGG -3'
(R):5'- TAACAGGAGGCAGTTACGCC -3'

Sequencing Primer
(F):5'- ACTTGGTTTTGCAGATCGTCC -3'
(R):5'- TTGCAGATGGCCACATATCG -3'
Posted On2016-06-06